Incidental Mutation 'R3749:Bub1b'
ID310077
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene NameBUB1B, mitotic checkpoint serine/threonine kinase
SynonymsBUBR1
MMRRC Submission 040734-MU
Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118598211-118641591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118615455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 319 (N319K)
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038341
AA Change: N319K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084
AA Change: N319K

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118630138 missense probably benign
IGL01319:Bub1b APN 2 118614994 missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118636749 missense probably damaging 0.99
IGL03184:Bub1b APN 2 118609777 splice site probably benign
P0035:Bub1b UTSW 2 118622185 missense probably damaging 1.00
R0315:Bub1b UTSW 2 118626976 splice site probably benign
R0322:Bub1b UTSW 2 118639618 splice site probably benign
R0378:Bub1b UTSW 2 118641123 missense probably benign 0.01
R0457:Bub1b UTSW 2 118609859 missense probably damaging 1.00
R0845:Bub1b UTSW 2 118609976 missense probably damaging 1.00
R0960:Bub1b UTSW 2 118606680 missense probably benign 0.03
R1071:Bub1b UTSW 2 118632447 frame shift probably null
R1129:Bub1b UTSW 2 118615006 missense probably damaging 1.00
R1138:Bub1b UTSW 2 118623089 missense probably benign 0.01
R1171:Bub1b UTSW 2 118606686 missense probably benign 0.31
R1613:Bub1b UTSW 2 118639741 critical splice donor site probably null
R1667:Bub1b UTSW 2 118641189 missense probably benign 0.00
R1812:Bub1b UTSW 2 118632421 missense probably benign 0.00
R1828:Bub1b UTSW 2 118638439 missense probably benign 0.00
R2085:Bub1b UTSW 2 118622195 missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118636718 nonsense probably null
R3750:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118630978 missense possibly damaging 0.78
R4579:Bub1b UTSW 2 118623176 nonsense probably null
R4993:Bub1b UTSW 2 118636770 missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118615499 missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118629989 missense probably damaging 1.00
R5596:Bub1b UTSW 2 118630982 missense probably damaging 1.00
R5656:Bub1b UTSW 2 118605431 missense probably damaging 1.00
R5785:Bub1b UTSW 2 118609844 missense probably damaging 0.98
R5883:Bub1b UTSW 2 118609882 missense probably damaging 1.00
R6128:Bub1b UTSW 2 118617812 missense probably benign
R6187:Bub1b UTSW 2 118631000 missense probably damaging 1.00
R6333:Bub1b UTSW 2 118598463 critical splice donor site probably null
R6985:Bub1b UTSW 2 118606614 missense probably damaging 1.00
R6988:Bub1b UTSW 2 118636830 missense probably damaging 0.96
R7161:Bub1b UTSW 2 118626053 missense probably damaging 1.00
R7341:Bub1b UTSW 2 118636786 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAACGAACTTCAGCCAGGC -3'
(R):5'- AGGTATATCTGGCGTCACTCC -3'

Sequencing Primer
(F):5'- AGCTTAGTCTAGCCTTGAACTTG -3'
(R):5'- GTCACTCCCTCCGAGATGC -3'
Posted On2015-04-17