Incidental Mutation 'R3749:Zkscan1'
ID310089
Institutional Source Beutler Lab
Gene Symbol Zkscan1
Ensembl Gene ENSMUSG00000029729
Gene Namezinc finger with KRAB and SCAN domains 1
Synonyms9230118B16Rik, KOX18, 9130423L19Rik, 5930429A01Rik
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138085084-138107822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138101441 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 476 (S476P)
Ref Sequence ENSEMBL: ENSMUSP00000106588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019660] [ENSMUST00000066617] [ENSMUST00000110962] [ENSMUST00000110963]
Predicted Effect probably damaging
Transcript: ENSMUST00000019660
AA Change: S549P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019660
Gene: ENSMUSG00000029729
AA Change: S549P

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 1.5e-75 SMART
KRAB 225 285 5.7e-8 SMART
low complexity region 300 314 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
ZnF_C2H2 375 397 1.3e-5 SMART
ZnF_C2H2 403 425 7.3e-6 SMART
ZnF_C2H2 431 453 5.6e-6 SMART
ZnF_C2H2 459 481 4e-7 SMART
ZnF_C2H2 487 509 3.8e-6 SMART
ZnF_C2H2 515 537 5.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066617
AA Change: S476P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068480
Gene: ENSMUSG00000029729
AA Change: S476P

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110962
AA Change: S476P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106587
Gene: ENSMUSG00000029729
AA Change: S476P

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110963
AA Change: S476P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106588
Gene: ENSMUSG00000029729
AA Change: S476P

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Zkscan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03172:Zkscan1 APN 5 138094002 missense probably benign 0.00
R0078:Zkscan1 UTSW 5 138093101 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0324:Zkscan1 UTSW 5 138097523 missense probably damaging 1.00
R0503:Zkscan1 UTSW 5 138093326 missense probably damaging 0.99
R0940:Zkscan1 UTSW 5 138093170 missense probably damaging 1.00
R1879:Zkscan1 UTSW 5 138097148 missense probably damaging 1.00
R1926:Zkscan1 UTSW 5 138101363 missense probably benign 0.33
R5045:Zkscan1 UTSW 5 138100920 missense probably damaging 1.00
R5391:Zkscan1 UTSW 5 138097101 missense probably benign
R6339:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R6936:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R7178:Zkscan1 UTSW 5 138100930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAATAACACCCCAGAGGAGGC -3'
(R):5'- GTTGATGTAACTGTTAGAGACCCTG -3'

Sequencing Primer
(F):5'- CCCTATGAATGTAACGAGTGTGGC -3'
(R):5'- CTGTTAGAGACCCTGAAGTGTGAC -3'
Posted On2015-04-17