Incidental Mutation 'R3889:Tbc1d17'
ID310186
Institutional Source Beutler Lab
Gene Symbol Tbc1d17
Ensembl Gene ENSMUSG00000038520
Gene NameTBC1 domain family, member 17
Synonyms
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R3889 (G1)
Quality Score221
Status Validated
Chromosome7
Chromosomal Location44834623-44849079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44845938 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 154 (H154L)
Ref Sequence ENSEMBL: ENSMUSP00000146488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047085] [ENSMUST00000054343] [ENSMUST00000107880] [ENSMUST00000107882] [ENSMUST00000107885] [ENSMUST00000136232] [ENSMUST00000141311] [ENSMUST00000145959] [ENSMUST00000150335] [ENSMUST00000207223] [ENSMUST00000207293] [ENSMUST00000207532] [ENSMUST00000208384]
Predicted Effect probably benign
Transcript: ENSMUST00000047085
AA Change: H154L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520
AA Change: H154L

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054343
SMART Domains Protein: ENSMUSP00000049764
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102096
Predicted Effect probably benign
Transcript: ENSMUST00000107880
SMART Domains Protein: ENSMUSP00000103512
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107882
SMART Domains Protein: ENSMUSP00000103514
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 59 86 N/A INTRINSIC
low complexity region 92 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107885
SMART Domains Protein: ENSMUSP00000103517
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 104 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
Pfam:PRAS 199 323 1.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133846
Predicted Effect probably benign
Transcript: ENSMUST00000136232
SMART Domains Protein: ENSMUSP00000116541
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect probably benign
Transcript: ENSMUST00000141311
SMART Domains Protein: ENSMUSP00000120690
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 40 67 N/A INTRINSIC
low complexity region 73 108 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
low complexity region 168 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142098
Predicted Effect probably benign
Transcript: ENSMUST00000142880
Predicted Effect probably benign
Transcript: ENSMUST00000145959
AA Change: H154L

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520
AA Change: H154L

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149921
Predicted Effect probably benign
Transcript: ENSMUST00000150335
SMART Domains Protein: ENSMUSP00000122607
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153161
Predicted Effect probably benign
Transcript: ENSMUST00000207223
Predicted Effect probably damaging
Transcript: ENSMUST00000207293
AA Change: H154L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207532
Predicted Effect probably benign
Transcript: ENSMUST00000208384
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Tbc1d17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Tbc1d17 APN 7 44843085 missense probably benign 0.00
IGL00791:Tbc1d17 APN 7 44845313 missense probably benign 0.04
IGL01865:Tbc1d17 APN 7 44842689 missense possibly damaging 0.90
IGL02468:Tbc1d17 APN 7 44848329 missense probably benign
IGL02829:Tbc1d17 APN 7 44848872 unclassified probably benign
PIT4431001:Tbc1d17 UTSW 7 44845074 missense probably benign
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0414:Tbc1d17 UTSW 7 44846059 missense probably benign 0.00
R0574:Tbc1d17 UTSW 7 44843123 unclassified probably benign
R0626:Tbc1d17 UTSW 7 44843085 missense probably benign 0.00
R0960:Tbc1d17 UTSW 7 44848428 splice site probably benign
R1203:Tbc1d17 UTSW 7 44843471 missense probably damaging 1.00
R1244:Tbc1d17 UTSW 7 44844398 missense probably damaging 0.99
R1730:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1783:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1899:Tbc1d17 UTSW 7 44841633 unclassified probably benign
R1953:Tbc1d17 UTSW 7 44841398 unclassified probably null
R2106:Tbc1d17 UTSW 7 44848268 critical splice donor site probably null
R4240:Tbc1d17 UTSW 7 44846826 missense probably damaging 1.00
R4547:Tbc1d17 UTSW 7 44841347 missense probably benign
R4787:Tbc1d17 UTSW 7 44843064 missense probably benign 0.02
R5422:Tbc1d17 UTSW 7 44848868 start codon destroyed probably null 0.98
R5569:Tbc1d17 UTSW 7 44848331 missense probably damaging 1.00
R5933:Tbc1d17 UTSW 7 44845337 missense probably damaging 0.96
R6502:Tbc1d17 UTSW 7 44841625 missense probably benign 0.30
R6838:Tbc1d17 UTSW 7 44844314 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATATTCTTAGCGCCTTCCGAC -3'
(R):5'- TGTTGAGAGAGCACACTGC -3'

Sequencing Primer
(F):5'- CCAGAACTGTGCTTCGACCATG -3'
(R):5'- GCACACTGCGTGGATCTACAC -3'
Posted On2015-04-17