Incidental Mutation 'R3889:Sgo2b'
ID310189
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Nameshugoshin 2B
SynonymsSgol2b, Gm4975
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R3889 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location63924694-63952248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63927743 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 685 (Q685R)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000179944
AA Change: Q685R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: Q685R

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210915
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0201:Sgo2b UTSW 8 63926636 missense probably benign
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3706:Sgo2b UTSW 8 63928145 missense probably damaging 0.98
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4259:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6296:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7289:Sgo2b UTSW 8 63941158 missense probably damaging 0.97
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCAGACTTATATGGCTCTGCAC -3'
(R):5'- GGCAACTTTCCCTTCCAAAC -3'

Sequencing Primer
(F):5'- CACTATCTTGGTTACAAAGAGCAGGC -3'
(R):5'- TTTCCCTTCCAAACCCAAGCAG -3'
Posted On2015-04-17