Incidental Mutation 'R3889:Adamts5'
ID310210
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms9530092O11Rik, ADAM-TS5
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3889 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location85856173-85901828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85868121 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 652 (W652R)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: W652R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: W652R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc25a45 C T 19: 5,880,633 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably null
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTCCCGAAAATAATGATGGTG -3'
(R):5'- TATGGAGGCACTTGAAACACTAG -3'

Sequencing Primer
(F):5'- CACTGCTCCAGACATAGA -3'
(R):5'- TCCTAGGTAAATCTTTTCGC -3'
Posted On2015-04-17