Incidental Mutation 'R3889:Slc25a45'
ID310218
Institutional Source Beutler Lab
Gene Symbol Slc25a45
Ensembl Gene ENSMUSG00000024818
Gene Namesolute carrier family 25, member 45
Synonyms
MMRRC Submission 040801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R3889 (G1)
Quality Score220
Status Validated
Chromosome19
Chromosomal Location5877808-5885766 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 5880633 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025732] [ENSMUST00000125114] [ENSMUST00000136833] [ENSMUST00000145200] [ENSMUST00000155697]
Predicted Effect probably benign
Transcript: ENSMUST00000025732
SMART Domains Protein: ENSMUSP00000025732
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 1.2e-20 PFAM
Pfam:Mito_carr 95 195 6.9e-22 PFAM
Pfam:Mito_carr 197 288 7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125114
SMART Domains Protein: ENSMUSP00000122076
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 4.7e-22 PFAM
Pfam:Mito_carr 95 195 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136833
SMART Domains Protein: ENSMUSP00000121602
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 102 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141362
SMART Domains Protein: ENSMUSP00000114648
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 70 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145200
SMART Domains Protein: ENSMUSP00000117220
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Mito_carr 37 137 5.1e-23 PFAM
Pfam:Mito_carr 139 195 4.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155697
SMART Domains Protein: ENSMUSP00000121596
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 8.9e-22 PFAM
Pfam:Mito_carr 95 195 6.8e-23 PFAM
Pfam:Mito_carr 197 288 2.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
7530416G11Rik A G 15: 85,494,091 F117S unknown Het
Adamts5 A G 16: 85,868,121 W652R probably damaging Het
Adamtsl4 G T 3: 95,680,857 Q607K probably damaging Het
Atm T C 9: 53,506,636 probably benign Het
Atp6v0a2 G A 5: 124,639,265 R168Q probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Baiap2l1 T C 5: 144,278,535 T387A possibly damaging Het
Cct3 A T 3: 88,321,027 Q472L probably benign Het
Chd3 C T 11: 69,359,185 E623K probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dclre1a A T 19: 56,545,320 C263S probably benign Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Epha3 A G 16: 63,610,964 F526L probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fat2 C A 11: 55,281,763 G2708V probably damaging Het
Fgd6 G A 10: 94,089,637 E853K probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Fsd1 A G 17: 55,993,893 K251E probably benign Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
H6pd T A 4: 149,995,773 Y197F possibly damaging Het
Hip1r C T 5: 124,001,791 R986* probably null Het
Igkv9-120 A G 6: 68,050,378 D92G probably damaging Het
Ikbkap G A 4: 56,759,852 R1138C probably damaging Het
Il6 A G 5: 30,018,068 K128E possibly damaging Het
Irf4 T C 13: 30,761,490 probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Ltbp2 A G 12: 84,784,907 probably benign Het
Pcmt1 C T 10: 7,649,050 probably null Het
Plekhm2 C T 4: 141,641,990 probably benign Het
Prkca C T 11: 107,979,240 G450R probably damaging Het
Psme3 C A 11: 101,319,456 P82T probably damaging Het
Rgs11 T C 17: 26,207,587 I262T probably damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Serpina1e A T 12: 103,950,873 V179E probably damaging Het
Sgo2b T C 8: 63,927,743 Q685R possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Spen A G 4: 141,477,881 V1145A unknown Het
Stub1 T C 17: 25,831,302 probably benign Het
Taar8a A G 10: 24,077,025 I176V probably benign Het
Tacr2 G A 10: 62,265,086 C325Y probably damaging Het
Tbc1d17 T A 7: 44,845,938 H154L probably damaging Het
Tll1 A T 8: 64,205,224 C54S possibly damaging Het
Tpsb2 G A 17: 25,367,483 V181I probably damaging Het
Trak1 A G 9: 121,445,873 N146S probably null Het
Vmn1r177 T C 7: 23,865,864 I196V possibly damaging Het
Zfp820 T C 17: 21,818,896 I484V probably benign Het
Other mutations in Slc25a45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Slc25a45 APN 19 5884609 splice site probably null
IGL02620:Slc25a45 APN 19 5884526 missense probably damaging 1.00
IGL02622:Slc25a45 APN 19 5878697 splice site probably benign
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0630:Slc25a45 UTSW 19 5880528 missense probably damaging 1.00
R1464:Slc25a45 UTSW 19 5879900 splice site probably benign
R1764:Slc25a45 UTSW 19 5884930 missense probably damaging 1.00
R1902:Slc25a45 UTSW 19 5884522 missense probably damaging 1.00
R2372:Slc25a45 UTSW 19 5884552 missense probably benign 0.00
R3547:Slc25a45 UTSW 19 5884546 missense probably damaging 1.00
R4173:Slc25a45 UTSW 19 5880583 nonsense probably null
R4222:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4223:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4225:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4598:Slc25a45 UTSW 19 5884436 missense probably damaging 1.00
R4998:Slc25a45 UTSW 19 5884917 missense probably damaging 1.00
R5063:Slc25a45 UTSW 19 5884462 missense possibly damaging 0.89
R5711:Slc25a45 UTSW 19 5884423 missense probably benign
R6693:Slc25a45 UTSW 19 5880134 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AATGAGTTTCCCCATCGCCAG -3'
(R):5'- ATTGACTGCTTCTGCCTGGC -3'

Sequencing Primer
(F):5'- AGTGTAGCCCTGGTCAACTC -3'
(R):5'- GGCATCTTCTTCACACTGACC -3'
Posted On2015-04-17