Incidental Mutation 'R3907:4930402H24Rik'
ID310233
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene NameRIKEN cDNA 4930402H24 gene
Synonyms
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130706200-130906406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130736576 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 663 (A663T)
Ref Sequence ENSEMBL: ENSMUSP00000113481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000119422]
Predicted Effect probably damaging
Transcript: ENSMUST00000044766
AA Change: A794T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309
AA Change: A794T

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119422
AA Change: A663T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309
AA Change: A663T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133132
Predicted Effect probably benign
Transcript: ENSMUST00000145851
SMART Domains Protein: ENSMUSP00000118946
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151673
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2046:4930402H24Rik UTSW 2 130810917 missense possibly damaging 0.61
R2374:4930402H24Rik UTSW 2 130820574 missense probably damaging 1.00
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6732:4930402H24Rik UTSW 2 130810820 critical splice donor site probably null
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATCCTGGTCTTTCTGAGG -3'
(R):5'- GTCCCACAGTAGCTCTCTCCATAG -3'

Sequencing Primer
(F):5'- TGTCCATAGCATTAGGGCAC -3'
(R):5'- TCCATAGTCATTGGCAGCATG -3'
Posted On2015-04-17