Incidental Mutation 'R3907:Ptpn6'
ID310246
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124725276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 347 (D347G)
Ref Sequence ENSEMBL: ENSMUSP00000129124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265] [ENSMUST00000174787]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
AA Change: D388G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: D388G

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112484
AA Change: D386G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: D386G

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171549
AA Change: D388G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: D388G

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172613
Predicted Effect probably benign
Transcript: ENSMUST00000172690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173228
Predicted Effect probably benign
Transcript: ENSMUST00000173315
Predicted Effect possibly damaging
Transcript: ENSMUST00000174265
AA Change: D347G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: D347G

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174787
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A794T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L534P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1573R probably damaging Het
Gm10110 T C 14: 89,898,147 D107G noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Rcan1 A G 16: 92,466,029 V17A probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P886L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 D4530Y probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 unclassified probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
spin UTSW 6 124728559 missense probably damaging 0.99
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATATCTCCCGAACCAG -3'
(R):5'- GTATGTATCTATACACACATGCACACC -3'

Sequencing Primer
(F):5'- TATCTCCCGAACCAGGTCCC -3'
(R):5'- TATACACACATGCACACCTCCCC -3'
Posted OnApr 17, 2015