Incidental Mutation 'R3907:Hars'
ID310278
Institutional Source Beutler Lab
Gene Symbol Hars
Ensembl Gene ENSMUSG00000001380
Gene Namehistidyl-tRNA synthetase
SynonymsMMHRS
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36766530-36783205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36782716 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 48 (D48E)
Ref Sequence ENSEMBL: ENSMUSP00000001416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000019287] [ENSMUST00000152954]
Predicted Effect probably benign
Transcript: ENSMUST00000001416
AA Change: D48E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380
AA Change: D48E

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019287
SMART Domains Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 313 1.3e-23 PFAM
Pfam:tRNA-synt_2b 72 234 2.8e-21 PFAM
Pfam:HGTP_anticodon2 324 424 2.7e-8 PFAM
Pfam:HGTP_anticodon 329 420 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145876
Predicted Effect probably benign
Transcript: ENSMUST00000152954
SMART Domains Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 389 1e-38 PFAM
Pfam:HGTP_anticodon 410 501 1.8e-16 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Hars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Hars APN 18 36768172 missense probably damaging 1.00
IGL01993:Hars APN 18 36770212 missense probably damaging 1.00
IGL03079:Hars APN 18 36770503 missense probably damaging 1.00
P0040:Hars UTSW 18 36773575 missense probably damaging 0.99
R0542:Hars UTSW 18 36771181 missense probably benign 0.23
R0630:Hars UTSW 18 36771389 missense probably damaging 1.00
R1171:Hars UTSW 18 36771414 missense possibly damaging 0.81
R1711:Hars UTSW 18 36771103 missense probably damaging 1.00
R1744:Hars UTSW 18 36770832 missense probably benign 0.00
R1873:Hars UTSW 18 36767241 missense probably damaging 0.99
R5193:Hars UTSW 18 36767305 missense possibly damaging 0.94
R5688:Hars UTSW 18 36772316 missense probably damaging 1.00
R6331:Hars UTSW 18 36771332 missense probably benign 0.19
R6349:Hars UTSW 18 36783054 missense probably benign 0.00
R6416:Hars UTSW 18 36773590 missense possibly damaging 0.95
R7075:Hars UTSW 18 36772355 missense possibly damaging 0.87
R7209:Hars UTSW 18 36773540 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATCACTGCCATCGCCGAATG -3'
(R):5'- CATAGAAGGTGATCTGGCTGG -3'

Sequencing Primer
(F):5'- ATCGCCGAATGACTCAGGTTG -3'
(R):5'- CCAGGCTGGTAGAGTGAAC -3'
Posted On2015-04-17