Incidental Mutation 'R0382:Cmya5'
ID31036
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93092748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1944 (V1944E)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: V1944E

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: V1944E

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense not run
R7088:Cmya5 UTSW 13 93091864 missense not run
R7126:Cmya5 UTSW 13 93089940 missense not run
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGCTAAGCTTTCGCCCATTCC -3'
(R):5'- GAAGTCACTCGTCACTGAGCAAGG -3'

Sequencing Primer
(F):5'- TCTGAGAAGCCTGGCAGTTC -3'
(R):5'- CTTCCTGCAGAGAAGGGAAAGAA -3'
Posted On2013-04-24