Incidental Mutation 'R3895:Rps3'
ID310495
Institutional Source Beutler Lab
Gene Symbol Rps3
Ensembl Gene ENSMUSG00000030744
Gene Nameribosomal protein S3
SynonymsD7Ertd795e
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R3895 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99477896-99483738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99479896 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 173 (R173H)
Ref Sequence ENSEMBL: ENSMUSP00000032998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032998] [ENSMUST00000107096] [ENSMUST00000208532]
Predicted Effect probably benign
Transcript: ENSMUST00000032998
AA Change: R173H

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032998
Gene: ENSMUSG00000030744
AA Change: R173H

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083888
Predicted Effect probably benign
Transcript: ENSMUST00000107096
SMART Domains Protein: ENSMUSP00000102713
Gene: ENSMUSG00000030744

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128725
Predicted Effect probably benign
Transcript: ENSMUST00000208532
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit, where it forms part of the domain where translation is initiated. The protein belongs to the S3P family of ribosomal proteins. Studies of the mouse and rat proteins have demonstrated that the protein has an extraribosomal role as an endonuclease involved in the repair of UV-induced DNA damage. The protein appears to be located in both the cytoplasm and nucleus but not in the nucleolus. Higher levels of expression of this gene in colon adenocarcinomas and adenomatous polyps compared to adjacent normal colonic mucosa have been observed. This gene is co-transcribed with the small nucleolar RNA genes U15A and U15B, which are located in its first and fifth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Rps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rps3 APN 7 99479272 critical splice donor site probably null
R3710:Rps3 UTSW 7 99479419 missense probably benign 0.02
R3894:Rps3 UTSW 7 99479896 missense probably benign 0.07
R4165:Rps3 UTSW 7 99483609 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGACGTGGCCATTCTGAC -3'
(R):5'- AAAGGGCCTGCTATGGTGTG -3'

Sequencing Primer
(F):5'- CGTCATCGTGTCATCACTGAAGG -3'
(R):5'- TGCTTCGGTTCATTATGGAGAG -3'
Posted On2015-04-17