Incidental Mutation 'R3895:Ccnd1'
ID310498
Institutional Source Beutler Lab
Gene Symbol Ccnd1
Ensembl Gene ENSMUSG00000070348
Gene Namecyclin D1
SynonymsCycD1, Cyl-1, cD1, PRAD1, bcl-1
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R3895 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144929931-144939925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144937894 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 136 (E136G)
Ref Sequence ENSEMBL: ENSMUSP00000091495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093962]
Predicted Effect probably damaging
Transcript: ENSMUST00000093962
AA Change: E136G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091495
Gene: ENSMUSG00000070348
AA Change: E136G

DomainStartEndE-ValueType
CYCLIN 62 146 1.2e-22 SMART
Cyclin_C 155 283 1.36e-18 SMART
CYCLIN 163 253 4.41e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208193
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of tumors and may contribute to tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations may exhibit reduced body size and viability, impaired retinal development, pregnancy-insensitive mammary glands, and modified development of mammary cancer induced by neu and ras oncogenes, depending on the specific allele or genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Ccnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Ccnd1 UTSW 7 144939665 missense probably benign 0.00
R0544:Ccnd1 UTSW 7 144937286 splice site probably benign
R1549:Ccnd1 UTSW 7 144937336 missense probably benign
R2054:Ccnd1 UTSW 7 144937391 missense possibly damaging 0.95
R3962:Ccnd1 UTSW 7 144934050 missense probably damaging 1.00
R5624:Ccnd1 UTSW 7 144938012 missense probably benign 0.00
R5710:Ccnd1 UTSW 7 144938044 missense possibly damaging 0.82
R6380:Ccnd1 UTSW 7 144939569 missense probably benign 0.00
X0026:Ccnd1 UTSW 7 144937952 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACATTTCAGAGTGGTTTCACC -3'
(R):5'- TGGCCATGAACTACCTGGAC -3'

Sequencing Primer
(F):5'- TGGTTTCACCACAGACATGG -3'
(R):5'- ATGAACTACCTGGACCGCTTC -3'
Posted On2015-04-17