Incidental Mutation 'R0383:Rif1'
ID31056
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission 038589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0383 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52085141 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 354 (M354K)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
Predicted Effect probably damaging
Transcript: ENSMUST00000069794
AA Change: M354K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: M354K

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: M354K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: M354K

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,239,539 M537V probably benign Het
5730455P16Rik G T 11: 80,363,941 Y351* probably null Het
A530099J19Rik A G 13: 19,729,147 noncoding transcript Het
Aadac G T 3: 60,035,947 R91L possibly damaging Het
Adgrg1 T A 8: 95,011,742 F621Y probably damaging Het
Ankmy1 G T 1: 92,885,053 D511E probably benign Het
Anks4b A T 7: 120,182,874 D376V probably damaging Het
Aox1 G T 1: 58,061,241 C399F probably benign Het
Arfgef1 C T 1: 10,198,842 probably null Het
Arhgef4 G A 1: 34,810,533 V546M probably damaging Het
Cab39 T A 1: 85,837,299 V98E probably damaging Het
Cacna1b T C 2: 24,761,844 N108D probably damaging Het
Car15 C A 16: 17,836,753 E134* probably null Het
Ccdc80 T G 16: 45,095,369 Y163D probably damaging Het
Col22a1 C T 15: 71,869,004 G513D unknown Het
Col8a1 T C 16: 57,632,442 D66G probably damaging Het
Crot C A 5: 8,968,734 S544I probably damaging Het
Cubn G T 2: 13,430,959 P1062Q probably damaging Het
Dcc A T 18: 71,420,263 V774E probably damaging Het
Dlgap5 T A 14: 47,410,361 M240L probably benign Het
Dlx4 A G 11: 95,145,435 V16A probably benign Het
Dnah17 G T 11: 118,067,547 H2703Q probably benign Het
Duox2 A G 2: 122,291,810 probably null Het
Fn1 C T 1: 71,597,685 V168I probably damaging Het
Fpr-rs4 A T 17: 18,022,097 D122V probably damaging Het
Gas2l2 A T 11: 83,423,097 I463N probably benign Het
Ggta1 G T 2: 35,402,404 P297Q probably damaging Het
Gpatch3 C A 4: 133,578,146 R231S probably damaging Het
Gpc1 T C 1: 92,854,983 Y151H probably damaging Het
Gtf2e2 T C 8: 33,755,945 W119R probably damaging Het
H2-M10.2 T C 17: 36,284,361 I304V probably benign Het
Helq T C 5: 100,779,165 K685R probably benign Het
Hps5 C T 7: 46,769,288 probably null Het
Iars T C 13: 49,732,342 C1186R probably damaging Het
Ift43 T C 12: 86,162,021 V158A possibly damaging Het
Iqca A T 1: 90,142,707 I141N probably damaging Het
Kat6b A G 14: 21,669,081 N1276S probably benign Het
Kif19a A T 11: 114,765,514 M1L possibly damaging Het
Kif1b T G 4: 149,202,512 H1241P probably damaging Het
Kif26a T C 12: 112,178,076 V1588A possibly damaging Het
Klb T A 5: 65,372,499 probably null Het
Krtap26-1 A T 16: 88,647,243 Y163* probably null Het
Lefty1 G T 1: 180,937,634 E256* probably null Het
Lox T C 18: 52,529,199 N44S possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mctp1 A G 13: 76,801,544 Y565C probably damaging Het
Megf6 C T 4: 154,265,326 A961V probably benign Het
Mindy4 A G 6: 55,276,634 K496R probably benign Het
Nalcn A T 14: 123,507,559 H352Q probably benign Het
Ncoa5 T C 2: 165,009,390 I188V possibly damaging Het
Notum G T 11: 120,654,456 H426N probably benign Het
Olfr569 T A 7: 102,887,251 I301F possibly damaging Het
Orm2 A T 4: 63,363,996 D137V probably damaging Het
Pabpc2 G A 18: 39,775,395 G571D probably damaging Het
Pabpc4 A G 4: 123,297,942 N599S probably damaging Het
Pak1ip1 T C 13: 41,012,604 V335A probably benign Het
Pcdhb11 A C 18: 37,423,393 D592A probably damaging Het
Pmch C A 10: 88,091,258 T41K possibly damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Pter G T 2: 13,000,942 G309* probably null Het
Ptprg T C 14: 12,219,024 V406A possibly damaging Het
Ranbp3l A T 15: 9,063,104 E467V possibly damaging Het
Ripk4 C T 16: 97,748,112 C248Y probably damaging Het
Slc6a15 T C 10: 103,418,053 W617R probably damaging Het
Smyd5 C T 6: 85,440,173 Q178* probably null Het
St18 T A 1: 6,803,024 F328I probably damaging Het
Supt20 T A 3: 54,703,149 L124* probably null Het
Tarbp1 T A 8: 126,447,484 H861L probably benign Het
Tars A G 15: 11,390,325 M356T probably benign Het
Tbc1d10a A G 11: 4,212,819 T221A probably damaging Het
Tead3 A G 17: 28,334,698 probably null Het
Tprg A G 16: 25,422,235 T254A probably damaging Het
Trank1 C A 9: 111,391,477 N2427K probably benign Het
Ttc30b A G 2: 75,938,242 Y56H probably damaging Het
Tufm T C 7: 126,489,864 S380P probably damaging Het
Tyrobp C T 7: 30,414,617 R68C probably damaging Het
Ubl4b T C 3: 107,554,827 E39G possibly damaging Het
Uggt2 A T 14: 119,049,451 F661I probably damaging Het
Upf3b A G X: 37,104,467 I144T probably benign Het
Usp54 A T 14: 20,561,252 D1165E probably benign Het
Vmn2r81 C T 10: 79,293,447 T724I possibly damaging Het
Vsig1 A G X: 140,936,313 I247M possibly damaging Het
Zfp110 C A 7: 12,849,260 L612I probably benign Het
Zfp318 C A 17: 46,413,296 T2075K probably damaging Het
Zfp37 A G 4: 62,191,885 M1T probably null Het
Zfp605 T A 5: 110,128,854 C613S probably damaging Het
Zfp729a G A 13: 67,621,673 P146S possibly damaging Het
Zfp85 T C 13: 67,748,672 N427S probably benign Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 intron probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 intron probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCATTAACGTAGGGAACAAGGCTGAG -3'
(R):5'- GGTAAGGATTCAAGGACACATgccag -3'

Sequencing Primer
(F):5'- catccttggcttgaatccac -3'
(R):5'- gatgaatacccctaatttcagcac -3'
Posted On2013-04-24