Incidental Mutation 'R3884:Selenon'
ID310580
Institutional Source Beutler Lab
Gene Symbol Selenon
Ensembl Gene ENSMUSG00000050989
Gene Nameselenoprotein N
SynonymsSepn1, 1110019I12Rik
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134537892-134552166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134539770 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 507 (N507S)
Ref Sequence ENSEMBL: ENSMUSP00000060026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060435] [ENSMUST00000102550] [ENSMUST00000116279] [ENSMUST00000131613] [ENSMUST00000146808] [ENSMUST00000154769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060435
AA Change: N507S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060026
Gene: ENSMUSG00000050989
AA Change: N507S

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1k94a_ 76 113 4e-3 SMART
low complexity region 160 179 N/A INTRINSIC
low complexity region 526 532 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102550
SMART Domains Protein: ENSMUSP00000099609
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 7 251 4.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116279
SMART Domains Protein: ENSMUSP00000111983
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 7 251 4.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130187
Predicted Effect probably benign
Transcript: ENSMUST00000131613
SMART Domains Protein: ENSMUSP00000123326
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 5 201 2.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146808
SMART Domains Protein: ENSMUSP00000120200
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 5 225 1.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154769
SMART Domains Protein: ENSMUSP00000117943
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 5 237 1.5e-84 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in the orthologous gene in human are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. Knockout mice deleted for this gene exhibit abnormal lung development. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit satellite cell loss and impaired muscle regeneration. Mice homozygous for a different knock-out allele exhibit subtle core lesions in skeletal muscle after induced oxidative stress and abnormal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Selenon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Selenon APN 4 134539726 unclassified probably benign
IGL02832:Selenon APN 4 134540908 missense probably damaging 1.00
IGL03015:Selenon APN 4 134545518 missense probably benign 0.43
I0000:Selenon UTSW 4 134542701 splice site probably benign
R1400:Selenon UTSW 4 134551518 missense probably benign 0.00
R1436:Selenon UTSW 4 134540686 missense probably damaging 1.00
R1932:Selenon UTSW 4 134544618 missense probably damaging 0.99
R2886:Selenon UTSW 4 134543069 missense probably null 1.00
R4647:Selenon UTSW 4 134545657 missense probably damaging 1.00
R4721:Selenon UTSW 4 134543076 nonsense probably null
R5091:Selenon UTSW 4 134547973 missense probably damaging 1.00
R5412:Selenon UTSW 4 134542438 missense probably benign 0.00
R5553:Selenon UTSW 4 134540917 missense probably damaging 1.00
R7048:Selenon UTSW 4 134542843 missense probably benign 0.04
R7222:Selenon UTSW 4 134547977 missense possibly damaging 0.60
R7470:Selenon UTSW 4 134539750 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTTACCAGGTCCAGGTCCTC -3'
(R):5'- GCTCTGGTGAGAAAATTCTTGG -3'

Sequencing Primer
(F):5'- TCCTCTAGGACTAGGGCTGGAG -3'
(R):5'- TACTGGTTCCTACCCTGGGAG -3'
Posted On2015-04-17