Incidental Mutation 'R3884:Olfr714'
ID310589
Institutional Source Beutler Lab
Gene Symbol Olfr714
Ensembl Gene ENSMUSG00000049674
Gene Nameolfactory receptor 714
SynonymsGA_x6K02T2PBJ9-9453401-9454354, P4, MOR263-2
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107070981-107077802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107073903 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 25 (Q25L)
Ref Sequence ENSEMBL: ENSMUSP00000151106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054629] [ENSMUST00000214429]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054629
AA Change: Q25L

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095742
Gene: ENSMUSG00000049674
AA Change: Q25L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.5e-56 PFAM
Pfam:7tm_1 42 291 3.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214123
Predicted Effect possibly damaging
Transcript: ENSMUST00000214429
AA Change: Q25L

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Olfr714
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Olfr714 APN 7 107074493 missense probably damaging 0.98
IGL02562:Olfr714 APN 7 107074562 missense probably benign 0.03
IGL02597:Olfr714 APN 7 107074439 missense possibly damaging 0.89
IGL02598:Olfr714 APN 7 107074716 missense possibly damaging 0.64
IGL02981:Olfr714 APN 7 107074551 missense probably damaging 1.00
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0518:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R0521:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R1661:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R1665:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R2069:Olfr714 UTSW 7 107074619 nonsense probably null
R2202:Olfr714 UTSW 7 107074316 missense probably damaging 1.00
R4362:Olfr714 UTSW 7 107074592 missense probably damaging 0.99
R4618:Olfr714 UTSW 7 107074554 missense probably damaging 1.00
R5375:Olfr714 UTSW 7 107073873 missense probably benign 0.05
R5654:Olfr714 UTSW 7 107074187 missense probably damaging 1.00
R6228:Olfr714 UTSW 7 107074136 missense probably damaging 1.00
R7196:Olfr714 UTSW 7 107074728 missense probably benign 0.01
R7202:Olfr714 UTSW 7 107074241 missense probably benign 0.01
R7232:Olfr714 UTSW 7 107073855 missense probably benign 0.03
Z1088:Olfr714 UTSW 7 107074405 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTCTTCCAAAGGATCCTGGC -3'
(R):5'- TTGTGTCCTGGGCAATCAGAG -3'

Sequencing Primer
(F):5'- CAAAGGATCCTGGCTTTGGCTC -3'
(R):5'- CAGAGTCCTCAACATTTTGGGCAG -3'
Posted On2015-04-17