Incidental Mutation 'R3884:Cnot7'
ID310590
Institutional Source Beutler Lab
Gene Symbol Cnot7
Ensembl Gene ENSMUSG00000031601
Gene NameCCR4-NOT transcription complex, subunit 7
SynonymsCaf1
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R3884 (G1)
Quality Score212
Status Not validated
Chromosome8
Chromosomal Location40492540-40515847 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 40510130 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000117304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000135269] [ENSMUST00000149992]
Predicted Effect probably null
Transcript: ENSMUST00000034012
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601
AA Change: M1K

DomainStartEndE-ValueType
Pfam:CAF1 15 139 9.1e-15 PFAM
Pfam:CAF1 132 238 1.2e-14 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098817
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128166
SMART Domains Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
Pfam:zf-DHHC 122 248 1.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128237
Predicted Effect probably null
Transcript: ENSMUST00000132032
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601
AA Change: M1K

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132740
Predicted Effect probably null
Transcript: ENSMUST00000135269
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601
AA Change: M1K

DomainStartEndE-ValueType
Pfam:CAF1 13 245 7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146280
Predicted Effect probably null
Transcript: ENSMUST00000149992
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601
AA Change: M1K

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164934
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display male sterility with oligo-teratozoospermia, impaired sperm motility, unsynchronized spermatid maturation, and Sertoli cell abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Cnot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cnot7 APN 8 40507449 splice site probably null
IGL02022:Cnot7 APN 8 40499345 missense probably damaging 1.00
IGL02191:Cnot7 APN 8 40510027 missense probably benign 0.33
R0047:Cnot7 UTSW 8 40495921 splice site probably benign
R0047:Cnot7 UTSW 8 40495921 splice site probably benign
R0166:Cnot7 UTSW 8 40507453 critical splice donor site probably null
R5369:Cnot7 UTSW 8 40494020 missense probably benign 0.12
R5991:Cnot7 UTSW 8 40495655 intron probably null
R6101:Cnot7 UTSW 8 40510037 missense probably benign
R6105:Cnot7 UTSW 8 40510037 missense probably benign
R7299:Cnot7 UTSW 8 40507545 missense probably damaging 1.00
R7548:Cnot7 UTSW 8 40500833 missense probably damaging 1.00
Z1088:Cnot7 UTSW 8 40500739 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TGGTTTTAACAGCCCACTCC -3'
(R):5'- TTCAGTTGGGAAATCGGCGG -3'

Sequencing Primer
(F):5'- CTATGCTTAAAAGGTGCATGGCCC -3'
(R):5'- TGAGAAAAGGAACTGTCTAAAACTTG -3'
Posted On2015-04-17