Mutagenetix > Incidental Mutation

Incidental Mutation 'R3884:Cnot7'

310590

Institutional Source

Beutler Lab

Gene Symbol

Cnot7

Ensembl Gene

ENSMUSG00000031601

Gene Name

CCR4-NOT transcription complex, subunit 7

Synonyms

Caf1

MMRRC Submission

040797-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.509) question?

Stock #

R3884 (G1)

Quality Score

212

Status

Not validated

Chromosome

Chromosomal Location

40945581-40968888 bp(-) (GRCm39)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to T at 40963171 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000117304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000135269] [ENSMUST00000149992]

AlphaFold

Q60809

Predicted Effect

probably null
Transcript: ENSMUST00000034012
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:CAF1	15	139	9.1e-15	PFAM
Pfam:CAF1	132	238	1.2e-14	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098817

SMART Domains

Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
Blast:UBCc	29	128	6e-6	BLAST
low complexity region	155	164	N/A	INTRINSIC
low complexity region	171	189	N/A	INTRINSIC
Pfam:Mod_r	235	380	2.7e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128166

SMART Domains

Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

Domain	Start	End	E-Value	Type
transmembrane domain	16	38	N/A	INTRINSIC
transmembrane domain	48	70	N/A	INTRINSIC
Pfam:zf-DHHC	122	248	1.8e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128237

Predicted Effect

probably null
Transcript: ENSMUST00000132032
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	240	3.4e-73	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132200

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132740

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144970

Predicted Effect

probably null
Transcript: ENSMUST00000135269
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	245	7e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146280

Predicted Effect

probably null
Transcript: ENSMUST00000149992
AA Change: M1K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	240	3.4e-73	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164934

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display male sterility with oligo-teratozoospermia, impaired sperm motility, unsynchronized spermatid maturation, and Sertoli cell abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	G	A	15: 98,495,055 (GRCm39)	S719F	probably benign	Het
Als2	A	G	1: 59,224,727 (GRCm39)	V998A	probably damaging	Het
Ankmy1	T	G	1: 92,813,874 (GRCm39)	E435A	probably damaging	Het
Ankrd52	A	G	10: 128,224,824 (GRCm39)	E820G	probably damaging	Het
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
Atp6v0d2	T	A	4: 19,910,677 (GRCm39)	D71V	probably damaging	Het
C3	T	C	17: 57,524,173 (GRCm39)		probably null	Het
Cntn2	A	G	1: 132,456,677 (GRCm39)	V123A	probably damaging	Het
Depdc5	G	A	5: 33,101,421 (GRCm39)	E904K	probably damaging	Het
Dip2c	G	T	13: 9,601,894 (GRCm39)	L284F	probably damaging	Het
Epb41l3	C	T	17: 69,581,111 (GRCm39)	R552*	probably null	Het
Gabra4	T	C	5: 71,814,600 (GRCm39)	D40G	probably benign	Het
Gm9925	T	C	18: 74,198,399 (GRCm39)		probably benign	Het
Igf2r	T	A	17: 12,928,355 (GRCm39)	Q996L	probably benign	Het
Klk1b16	T	C	7: 43,788,887 (GRCm39)	V40A	possibly damaging	Het
Lin9	G	T	1: 180,515,630 (GRCm39)	G427*	probably null	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACA	12: 40,235,260 (GRCm39)		probably null	Het
Lyg2	C	G	1: 37,949,150 (GRCm39)	A71P	probably damaging	Het
Mycbp2	A	C	14: 103,532,686 (GRCm39)	L390V	probably damaging	Het
Myl3	A	G	9: 110,597,027 (GRCm39)	H129R	probably damaging	Het
Naa16	T	C	14: 79,580,702 (GRCm39)	K604R	probably damaging	Het
Nedd4	C	T	9: 72,632,359 (GRCm39)	P398S	probably benign	Het
Neurl1a	T	C	19: 47,241,885 (GRCm39)	V309A	probably benign	Het
Or10a2	A	T	7: 106,673,110 (GRCm39)	Q25L	possibly damaging	Het
Or6c210	T	C	10: 129,496,407 (GRCm39)	V244A	probably damaging	Het
Pacs1	T	C	19: 5,205,787 (GRCm39)	Y301C	probably damaging	Het
Parl	A	T	16: 20,101,762 (GRCm39)	M90K	probably damaging	Het
Plxnc1	A	T	10: 94,746,549 (GRCm39)		probably null	Het
Prkd2	C	A	7: 16,587,180 (GRCm39)	S375R	probably benign	Het
Prss44	T	C	9: 110,643,764 (GRCm39)	I136T	possibly damaging	Het
Rock1	G	A	18: 10,122,768 (GRCm39)	T351I	probably damaging	Het
Selenon	T	C	4: 134,267,081 (GRCm39)	N507S	possibly damaging	Het
Slc38a7	C	T	8: 96,572,809 (GRCm39)	G141R	probably damaging	Het
Trpm4	C	T	7: 44,971,422 (GRCm39)		probably null	Het
Ttn	T	A	2: 76,560,705 (GRCm39)	N27486I	probably damaging	Het
Xylb	T	C	9: 119,209,753 (GRCm39)	M346T	probably damaging	Het
Zbtb17	T	C	4: 141,191,886 (GRCm39)	F306L	probably damaging	Het

Other mutations in Cnot7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01474:Cnot7	APN	8	40,960,490 (GRCm39)	splice site	probably null
IGL02022:Cnot7	APN	8	40,952,386 (GRCm39)	missense	probably damaging	1.00
IGL02191:Cnot7	APN	8	40,963,068 (GRCm39)	missense	probably benign	0.33
R0047:Cnot7	UTSW	8	40,948,962 (GRCm39)	splice site	probably benign
R0047:Cnot7	UTSW	8	40,948,962 (GRCm39)	splice site	probably benign
R0166:Cnot7	UTSW	8	40,960,494 (GRCm39)	critical splice donor site	probably null
R5369:Cnot7	UTSW	8	40,947,061 (GRCm39)	missense	probably benign	0.12
R5991:Cnot7	UTSW	8	40,948,696 (GRCm39)	splice site	probably null
R6101:Cnot7	UTSW	8	40,963,078 (GRCm39)	missense	probably benign
R6105:Cnot7	UTSW	8	40,963,078 (GRCm39)	missense	probably benign
R7299:Cnot7	UTSW	8	40,960,586 (GRCm39)	missense	probably damaging	1.00
R7548:Cnot7	UTSW	8	40,953,874 (GRCm39)	missense	probably damaging	1.00
R7639:Cnot7	UTSW	8	40,960,494 (GRCm39)	critical splice donor site	probably null
R7712:Cnot7	UTSW	8	40,947,122 (GRCm39)	missense	probably damaging	1.00
R8069:Cnot7	UTSW	8	40,960,514 (GRCm39)	missense	possibly damaging	0.95
R8128:Cnot7	UTSW	8	40,963,129 (GRCm39)	missense	probably damaging	1.00
R8757:Cnot7	UTSW	8	40,947,080 (GRCm39)	missense	probably benign
R9251:Cnot7	UTSW	8	40,964,622 (GRCm39)	unclassified	probably benign
Z1088:Cnot7	UTSW	8	40,953,780 (GRCm39)	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTTTTAACAGCCCACTCC -3'
(R):5'- TTCAGTTGGGAAATCGGCGG -3'

Sequencing Primer
(F):5'- CTATGCTTAAAAGGTGCATGGCCC -3'
(R):5'- TGAGAAAAGGAACTGTCTAAAACTTG -3'

Posted On

2015-04-17