Incidental Mutation 'R3884:Ankrd52'
ID310598
Institutional Source Beutler Lab
Gene Symbol Ankrd52
Ensembl Gene ENSMUSG00000014498
Gene Nameankyrin repeat domain 52
SynonymsG431002C21Rik
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128377115-128408704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128388955 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 820 (E820G)
Ref Sequence ENSEMBL: ENSMUSP00000014642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642]
Predicted Effect probably damaging
Transcript: ENSMUST00000014642
AA Change: E820G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498
AA Change: E820G

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198839
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Ankrd52
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Ankrd52 UTSW 10 128386452 missense probably benign 0.37
R0014:Ankrd52 UTSW 10 128386452 missense probably benign 0.37
R0139:Ankrd52 UTSW 10 128386138 missense probably benign 0.35
R0226:Ankrd52 UTSW 10 128389858 splice site probably null
R1355:Ankrd52 UTSW 10 128388696 missense possibly damaging 0.48
R1370:Ankrd52 UTSW 10 128388696 missense possibly damaging 0.48
R2190:Ankrd52 UTSW 10 128383618 missense probably benign 0.01
R2566:Ankrd52 UTSW 10 128389351 missense probably benign 0.39
R4624:Ankrd52 UTSW 10 128389259 missense probably damaging 1.00
R4706:Ankrd52 UTSW 10 128378161 missense probably benign
R4750:Ankrd52 UTSW 10 128378089 missense probably damaging 1.00
R4790:Ankrd52 UTSW 10 128380945 missense possibly damaging 0.62
R4965:Ankrd52 UTSW 10 128390507 missense probably benign 0.08
R5060:Ankrd52 UTSW 10 128389841 missense possibly damaging 0.87
R5446:Ankrd52 UTSW 10 128388561 missense probably damaging 1.00
R5798:Ankrd52 UTSW 10 128387610 missense probably benign 0.01
R5977:Ankrd52 UTSW 10 128382697 missense probably damaging 1.00
R5998:Ankrd52 UTSW 10 128383123 missense probably damaging 1.00
R6107:Ankrd52 UTSW 10 128387012 missense probably benign 0.19
R6478:Ankrd52 UTSW 10 128379331 intron probably null
R6579:Ankrd52 UTSW 10 128387142 missense probably damaging 1.00
R6937:Ankrd52 UTSW 10 128387020 missense probably benign 0.42
R7078:Ankrd52 UTSW 10 128383657 missense probably benign 0.01
R7101:Ankrd52 UTSW 10 128382380 missense probably damaging 1.00
R7252:Ankrd52 UTSW 10 128381996 missense probably damaging 1.00
R7324:Ankrd52 UTSW 10 128386163 missense possibly damaging 0.74
X0028:Ankrd52 UTSW 10 128381851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTACACTGGTACTAGTGGGG -3'
(R):5'- TCACAATCTTGGCACCCAGAG -3'

Sequencing Primer
(F):5'- CCTTTGATAGGCATAGGGACG -3'
(R):5'- GCCCCCAGCAGCATCTC -3'
Posted On2015-04-17