Incidental Mutation 'R3884:Parl'
ID310608
Institutional Source Beutler Lab
Gene Symbol Parl
Ensembl Gene ENSMUSG00000033918
Gene Namepresenilin associated, rhomboid-like
SynonymsD16Ertd607e, PSENIP2, PRO2207, PSARL1, Psarl
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20279818-20302387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20283012 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 90 (M90K)
Ref Sequence ENSEMBL: ENSMUSP00000155904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048642] [ENSMUST00000133153] [ENSMUST00000136252] [ENSMUST00000152887] [ENSMUST00000232036] [ENSMUST00000232484]
Predicted Effect probably damaging
Transcript: ENSMUST00000048642
AA Change: M279K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045361
Gene: ENSMUSG00000033918
AA Change: M279K

DomainStartEndE-ValueType
transmembrane domain 100 119 N/A INTRINSIC
transmembrane domain 166 185 N/A INTRINSIC
Pfam:Rhomboid 199 351 9.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126001
Predicted Effect probably benign
Transcript: ENSMUST00000133153
Predicted Effect probably benign
Transcript: ENSMUST00000136252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136700
Predicted Effect probably damaging
Transcript: ENSMUST00000152887
AA Change: M90K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155832
Predicted Effect probably benign
Transcript: ENSMUST00000231547
Predicted Effect probably benign
Transcript: ENSMUST00000232036
Predicted Effect probably benign
Transcript: ENSMUST00000232484
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhomboid family of intramembrane serine proteases that is localized to the inner mitochondrial membrane. The encoded protein regulates mitochondrial remodeling and apoptosis through regulated substrate proteolysis. Proteolytic processing of the encoded protein results in the release of a small peptide, P-beta, which may transit to the nucleus. Mutations in this gene may be associated with Parkinson's disease. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice show stunted growth, lymphocyte and neuron apoptosis, faster apoptotic cristae remodeling and cytochrome c release from mitochondria, dyspnea, cryptorchism, reduced testes and epididymi, kyphosis and premature death due to progressive cachexia sustained by multisystemic atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Parl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Parl APN 16 20298208 missense probably damaging 0.99
IGL01013:Parl APN 16 20282790 missense possibly damaging 0.50
IGL02159:Parl APN 16 20280088 splice site probably benign
IGL02189:Parl APN 16 20297703 missense probably damaging 1.00
R0233:Parl UTSW 16 20287907 missense probably damaging 0.96
R1301:Parl UTSW 16 20286926 missense probably damaging 1.00
R1954:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R1955:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R2353:Parl UTSW 16 20287040 missense probably benign 0.08
R5345:Parl UTSW 16 20298142 missense probably damaging 0.99
R5477:Parl UTSW 16 20280074 missense possibly damaging 0.90
R5567:Parl UTSW 16 20283012 missense probably damaging 0.97
R5687:Parl UTSW 16 20287978 intron probably benign
R6238:Parl UTSW 16 20302213 missense possibly damaging 0.94
R7311:Parl UTSW 16 20287875 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGTATCCATGGCAATGATG -3'
(R):5'- TTATGTGACAACCTGGGTCCC -3'

Sequencing Primer
(F):5'- GCCTAGAAGCCAGGAAGATAAAAC -3'
(R):5'- GGGTCCCTTTCTCTGATACTGTG -3'
Posted On2015-04-17