Incidental Mutation 'R3884:Epb41l3'
ID310612
Institutional Source Beutler Lab
Gene Symbol Epb41l3
Ensembl Gene ENSMUSG00000024044
Gene Nameerythrocyte membrane protein band 4.1 like 3
SynonymsDAL1P, NBL3, Epb4.1l3, 4.1B
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location69075683-69289989 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 69274116 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 552 (R552*)
Ref Sequence ENSEMBL: ENSMUSP00000108300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080208] [ENSMUST00000112680] [ENSMUST00000225695] [ENSMUST00000225740] [ENSMUST00000225977]
Predicted Effect probably benign
Transcript: ENSMUST00000080208
SMART Domains Protein: ENSMUSP00000079098
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 556 604 2.1e-29 PFAM
low complexity region 789 802 N/A INTRINSIC
Pfam:4_1_CTD 809 922 1.9e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112680
AA Change: R552*
SMART Domains Protein: ENSMUSP00000108300
Gene: ENSMUSG00000024044
AA Change: R552*

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 566 614 3.2e-28 PFAM
low complexity region 799 812 N/A INTRINSIC
Pfam:4_1_CTD 825 931 2.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187090
Predicted Effect probably benign
Transcript: ENSMUST00000223703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223816
Predicted Effect probably benign
Transcript: ENSMUST00000224523
Predicted Effect probably benign
Transcript: ENSMUST00000224951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225316
Predicted Effect probably benign
Transcript: ENSMUST00000225695
Predicted Effect probably benign
Transcript: ENSMUST00000225740
Predicted Effect probably benign
Transcript: ENSMUST00000225977
Meta Mutation Damage Score 0.6348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele display a normal phenotype. Mice homozygous for a different knock-out allele exhibit ataxia, gait abnormalities, clasping, hypermyelination, abnormal axon morphology, and decreased internode length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Epb41l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Epb41l3 APN 17 69207861 splice site probably benign
IGL01099:Epb41l3 APN 17 69210193 missense possibly damaging 0.80
IGL01578:Epb41l3 APN 17 69248709 missense probably damaging 1.00
IGL02269:Epb41l3 APN 17 69247573 missense probably damaging 1.00
IGL02926:Epb41l3 APN 17 69247746 missense probably damaging 1.00
IGL03397:Epb41l3 APN 17 69248692 missense probably damaging 1.00
E0370:Epb41l3 UTSW 17 69274804 missense possibly damaging 0.73
P0031:Epb41l3 UTSW 17 69259054 nonsense probably null
R0032:Epb41l3 UTSW 17 69210384 critical splice donor site probably null
R0056:Epb41l3 UTSW 17 69253397 missense probably damaging 1.00
R0092:Epb41l3 UTSW 17 69286750 missense probably damaging 1.00
R0499:Epb41l3 UTSW 17 69247659 missense probably benign 0.00
R0560:Epb41l3 UTSW 17 69274897 critical splice donor site probably null
R1164:Epb41l3 UTSW 17 69274767 missense possibly damaging 0.93
R1170:Epb41l3 UTSW 17 69259180 nonsense probably null
R1397:Epb41l3 UTSW 17 69262348 critical splice donor site probably null
R2080:Epb41l3 UTSW 17 69253468 missense possibly damaging 0.54
R2138:Epb41l3 UTSW 17 69207880 missense probably damaging 1.00
R2279:Epb41l3 UTSW 17 69270650 missense possibly damaging 0.56
R2863:Epb41l3 UTSW 17 69210321 missense probably benign 0.22
R3883:Epb41l3 UTSW 17 69274116 nonsense probably null
R4165:Epb41l3 UTSW 17 69207888 missense probably damaging 1.00
R4795:Epb41l3 UTSW 17 69248719 critical splice donor site probably null
R5286:Epb41l3 UTSW 17 69262273 missense probably benign 0.00
R5303:Epb41l3 UTSW 17 69257449 missense probably damaging 1.00
R5373:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5374:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5938:Epb41l3 UTSW 17 69259071 missense probably damaging 1.00
R6014:Epb41l3 UTSW 17 69283960 missense probably damaging 0.98
R6059:Epb41l3 UTSW 17 69284642 missense probably damaging 1.00
R6059:Epb41l3 UTSW 17 69286798 missense probably damaging 1.00
R7318:Epb41l3 UTSW 17 69266140 missense
R7548:Epb41l3 UTSW 17 69210276 missense probably damaging 1.00
X0066:Epb41l3 UTSW 17 69259158 nonsense probably null
Z1088:Epb41l3 UTSW 17 69253522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCGATGCTGGCAGTC -3'
(R):5'- AGTAAGCCGAGAAGTCAGCC -3'

Sequencing Primer
(F):5'- TAAAGATCTGGCGACCCCCG -3'
(R):5'- GAGAAGTCAGCCCATCCCTG -3'
Posted On2015-04-17