Incidental Mutation 'R3884:Arsi'
ID310614
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Namearylsulfatase i
Synonyms
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3884 (G1)
Quality Score222
Status Not validated
Chromosome18
Chromosomal Location60911780-60918561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60916651 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 202 (G202E)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
Predicted Effect probably benign
Transcript: ENSMUST00000040359
AA Change: G202E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: G202E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1641:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2484:Arsi UTSW 18 60916651 missense probably benign 0.07
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2995:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4212:Arsi UTSW 18 60916701 missense probably damaging 1.00
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4459:Arsi UTSW 18 60916651 missense probably benign 0.07
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCAGCACTCCATTATCCGC -3'
(R):5'- TCACCATGGCTGCGTACTTG -3'

Sequencing Primer
(F):5'- TACAGGAGGCAGGCTACTC -3'
(R):5'- TACTTGCGCCGTGCTACG -3'
Posted On2015-04-17