Incidental Mutation 'R3884:Gm9925'
ID310615
Institutional Source Beutler Lab
Gene Symbol Gm9925
Ensembl Gene ENSMUSG00000053861
Gene Namepredicted gene 9925
Synonyms
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location74065102-74065584 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 74065328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066583] [ENSMUST00000091851] [ENSMUST00000159162] [ENSMUST00000162863]
Predicted Effect unknown
Transcript: ENSMUST00000066583
AA Change: L76S
Predicted Effect probably benign
Transcript: ENSMUST00000091851
SMART Domains Protein: ENSMUSP00000089462
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
S_TKc 20 312 3.81e-79 SMART
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159162
SMART Domains Protein: ENSMUSP00000123922
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 232 2.3e-58 PFAM
Pfam:Pkinase_Tyr 22 232 5.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160601
Predicted Effect probably benign
Transcript: ENSMUST00000162863
SMART Domains Protein: ENSMUSP00000124408
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 192 1.7e-41 PFAM
Pfam:Pkinase_Tyr 22 189 5.9e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Gm9925
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1706:Gm9925 UTSW 18 74065502 unclassified probably benign
R4780:Gm9925 UTSW 18 74065273 unclassified probably benign
R5975:Gm9925 UTSW 18 74065516 unclassified probably benign
R6234:Gm9925 UTSW 18 74065237 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCTTTTGCAGTTCCCAG -3'
(R):5'- AGCCTAGATCTGCTGCACG -3'

Sequencing Primer
(F):5'- CTGAGCAGCCGGGTTTCTG -3'
(R):5'- TAGTGACCTGAGCTCCC -3'
Posted On2015-04-17