Incidental Mutation 'R3884:Neurl1a'
ID310617
Institutional Source Beutler Lab
Gene Symbol Neurl1a
Ensembl Gene ENSMUSG00000006435
Gene Nameneuralized E3 ubiquitin protein ligase 1A
SynonymsNeur1, Rnf67, Neurl, Neu1, Nlz, 2410129E16Rik
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R3884 (G1)
Quality Score80.5
Status Not validated
Chromosome19
Chromosomal Location47178820-47259440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47253446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000107438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111807] [ENSMUST00000111808]
Predicted Effect probably benign
Transcript: ENSMUST00000111807
AA Change: V309A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107438
Gene: ENSMUSG00000006435
AA Change: V309A

DomainStartEndE-ValueType
NEUZ 43 166 8.33e-66 SMART
Blast:NEUZ 186 213 1e-8 BLAST
low complexity region 241 253 N/A INTRINSIC
NEUZ 274 397 1.79e-56 SMART
low complexity region 440 456 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
RING 504 543 2.22e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111808
AA Change: V326A

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107439
Gene: ENSMUSG00000006435
AA Change: V326A

DomainStartEndE-ValueType
NEUZ 60 183 8.33e-66 SMART
Blast:NEUZ 203 230 9e-9 BLAST
low complexity region 258 270 N/A INTRINSIC
NEUZ 291 414 1.79e-56 SMART
low complexity region 457 473 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
RING 521 560 2.22e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Depending on the targeted mutation, homozygotes show a spectrum of conflicting phenotypes ranging from axonemal and spermatid abnormalities, male sterility and deficient lactation, to just a specific olfactory discrimination defect and ethanol hypersensitivity on motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Neurl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Neurl1a APN 19 47240477 missense probably damaging 0.99
R1403:Neurl1a UTSW 19 47253711 missense probably damaging 1.00
R1822:Neurl1a UTSW 19 47257459 missense probably benign 0.16
R3040:Neurl1a UTSW 19 47239831 missense probably benign 0.00
R3435:Neurl1a UTSW 19 47257525 missense probably damaging 1.00
R3767:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3770:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R4539:Neurl1a UTSW 19 47256744 missense probably damaging 1.00
R5108:Neurl1a UTSW 19 47257635 missense probably damaging 1.00
R5644:Neurl1a UTSW 19 47179477 missense probably benign
R6167:Neurl1a UTSW 19 47239928 missense probably damaging 1.00
R7353:Neurl1a UTSW 19 47240660 missense probably damaging 1.00
X0063:Neurl1a UTSW 19 47253674 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TACCTGAGCAGTAGTATCTTTAGTGC -3'
(R):5'- TTGTGACTCAGGTGCAGCTC -3'

Sequencing Primer
(F):5'- TGTGCGACCTCAACGTG -3'
(R):5'- TCAGGTGCAGCTCTCCGTC -3'
Posted On2015-04-17