Incidental Mutation 'R3955:1110002E22Rik'
ID310633
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 040832-MU
Accession Numbers
Stock #R3955 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138068073 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1008 (T1008A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: T1008A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: T1008A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Meta Mutation Damage Score 0.008question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 unknown Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I234T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C219R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D163G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R290* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T77S probably benign Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y1173C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N probably benign Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCGGAGTCAGAACAGC -3'
(R):5'- ACGGAAGAGTTTCTGCTGGG -3'

Sequencing Primer
(F):5'- GAGTCAGAACAGCGCCTTC -3'
(R):5'- GGTTCTGCTGTTATCCTCAATG -3'
Posted OnApr 29, 2015