Incidental Mutation 'R3955:Trim30d'
ID310649
Institutional Source Beutler Lab
Gene Symbol Trim30d
Ensembl Gene ENSMUSG00000057596
Gene Nametripartite motif-containing 30D
SynonymsTrim79, TRIM30-3
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3955 (G1)
Quality Score200
Status Validated
Chromosome7
Chromosomal Location104470014-104507849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104472521 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 339 (G339D)
Ref Sequence ENSEMBL: ENSMUSP00000033211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033211] [ENSMUST00000071069]
Predicted Effect probably damaging
Transcript: ENSMUST00000033211
AA Change: G339D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033211
Gene: ENSMUSG00000057596
AA Change: G339D

DomainStartEndE-ValueType
RING 15 58 1.72e-8 SMART
BBOX 91 132 5.25e-13 SMART
low complexity region 196 228 N/A INTRINSIC
Pfam:SPRY 350 491 1.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071069
AA Change: G189D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065020
Gene: ENSMUSG00000057596
AA Change: G189D

DomainStartEndE-ValueType
coiled coil region 23 84 N/A INTRINSIC
Pfam:SPRY 198 346 1.1e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141063
AA Change: G112D
SMART Domains Protein: ENSMUSP00000115684
Gene: ENSMUSG00000057596
AA Change: G112D

DomainStartEndE-ValueType
PDB:4B3N|B 58 197 3e-19 PDB
Blast:SPRY 122 209 4e-13 BLAST
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Trim30d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Trim30d APN 7 104472126 missense possibly damaging 0.81
IGL01818:Trim30d APN 7 104472060 missense probably damaging 1.00
IGL02552:Trim30d APN 7 104472416 missense probably damaging 0.98
IGL03000:Trim30d APN 7 104473269 missense probably benign 0.26
R0608:Trim30d UTSW 7 104472485 missense probably damaging 0.99
R0629:Trim30d UTSW 7 104487655 missense probably damaging 1.00
R1390:Trim30d UTSW 7 104483403 missense probably benign 0.41
R1460:Trim30d UTSW 7 104472104 missense probably benign 0.00
R1474:Trim30d UTSW 7 104472494 missense probably damaging 1.00
R1701:Trim30d UTSW 7 104484182 nonsense probably null
R1799:Trim30d UTSW 7 104483475 missense probably damaging 0.98
R2295:Trim30d UTSW 7 104487942 missense probably damaging 1.00
R3898:Trim30d UTSW 7 104483529 missense probably benign 0.01
R3953:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3954:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3957:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R4086:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4087:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4089:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4580:Trim30d UTSW 7 104472558 missense possibly damaging 0.68
R4596:Trim30d UTSW 7 104472526 missense probably benign 0.02
R4926:Trim30d UTSW 7 104483357 missense probably benign 0.09
R5071:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5074:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5294:Trim30d UTSW 7 104472488 missense probably damaging 1.00
R5477:Trim30d UTSW 7 104472140 missense probably damaging 1.00
R5629:Trim30d UTSW 7 104487929 missense possibly damaging 0.87
R5743:Trim30d UTSW 7 104472328 nonsense probably null
R6178:Trim30d UTSW 7 104487995 start codon destroyed probably damaging 1.00
R6244:Trim30d UTSW 7 104487610 missense probably damaging 1.00
R6937:Trim30d UTSW 7 104483427 missense probably damaging 1.00
R7014:Trim30d UTSW 7 104483336 missense probably benign 0.01
R7323:Trim30d UTSW 7 104483348 missense probably benign 0.41
X0026:Trim30d UTSW 7 104487965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACATTTAGGCTGAAACG -3'
(R):5'- TGACTTTAAACAAGGCTTCTCCG -3'

Sequencing Primer
(F):5'- CATTTAGGCTGAAACGTTACATTTTG -3'
(R):5'- GCTTAAGTTACAAATAAGGCTGTACC -3'
Posted On2015-04-29