Incidental Mutation 'R0383:Crot'
ID31071
Institutional Source Beutler Lab
Gene Symbol Crot
Ensembl Gene ENSMUSG00000003623
Gene Namecarnitine O-octanoyltransferase
Synonyms1200003H03Rik
MMRRC Submission 038589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0383 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8966033-8997324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8968734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 544 (S544I)
Ref Sequence ENSEMBL: ENSMUSP00000003720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003720]
PDB Structure
Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003720
AA Change: S544I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: S544I

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 20 604 2.3e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146115
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,239,539 M537V probably benign Het
5730455P16Rik G T 11: 80,363,941 Y351* probably null Het
A530099J19Rik A G 13: 19,729,147 noncoding transcript Het
Aadac G T 3: 60,035,947 R91L possibly damaging Het
Adgrg1 T A 8: 95,011,742 F621Y probably damaging Het
Ankmy1 G T 1: 92,885,053 D511E probably benign Het
Anks4b A T 7: 120,182,874 D376V probably damaging Het
Aox1 G T 1: 58,061,241 C399F probably benign Het
Arfgef1 C T 1: 10,198,842 probably null Het
Arhgef4 G A 1: 34,810,533 V546M probably damaging Het
Cab39 T A 1: 85,837,299 V98E probably damaging Het
Cacna1b T C 2: 24,761,844 N108D probably damaging Het
Car15 C A 16: 17,836,753 E134* probably null Het
Ccdc80 T G 16: 45,095,369 Y163D probably damaging Het
Col22a1 C T 15: 71,869,004 G513D unknown Het
Col8a1 T C 16: 57,632,442 D66G probably damaging Het
Cubn G T 2: 13,430,959 P1062Q probably damaging Het
Dcc A T 18: 71,420,263 V774E probably damaging Het
Dlgap5 T A 14: 47,410,361 M240L probably benign Het
Dlx4 A G 11: 95,145,435 V16A probably benign Het
Dnah17 G T 11: 118,067,547 H2703Q probably benign Het
Duox2 A G 2: 122,291,810 probably null Het
Fn1 C T 1: 71,597,685 V168I probably damaging Het
Fpr-rs4 A T 17: 18,022,097 D122V probably damaging Het
Gas2l2 A T 11: 83,423,097 I463N probably benign Het
Ggta1 G T 2: 35,402,404 P297Q probably damaging Het
Gpatch3 C A 4: 133,578,146 R231S probably damaging Het
Gpc1 T C 1: 92,854,983 Y151H probably damaging Het
Gtf2e2 T C 8: 33,755,945 W119R probably damaging Het
H2-M10.2 T C 17: 36,284,361 I304V probably benign Het
Helq T C 5: 100,779,165 K685R probably benign Het
Hps5 C T 7: 46,769,288 probably null Het
Iars T C 13: 49,732,342 C1186R probably damaging Het
Ift43 T C 12: 86,162,021 V158A possibly damaging Het
Iqca A T 1: 90,142,707 I141N probably damaging Het
Kat6b A G 14: 21,669,081 N1276S probably benign Het
Kif19a A T 11: 114,765,514 M1L possibly damaging Het
Kif1b T G 4: 149,202,512 H1241P probably damaging Het
Kif26a T C 12: 112,178,076 V1588A possibly damaging Het
Klb T A 5: 65,372,499 probably null Het
Krtap26-1 A T 16: 88,647,243 Y163* probably null Het
Lefty1 G T 1: 180,937,634 E256* probably null Het
Lox T C 18: 52,529,199 N44S possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mctp1 A G 13: 76,801,544 Y565C probably damaging Het
Megf6 C T 4: 154,265,326 A961V probably benign Het
Mindy4 A G 6: 55,276,634 K496R probably benign Het
Nalcn A T 14: 123,507,559 H352Q probably benign Het
Ncoa5 T C 2: 165,009,390 I188V possibly damaging Het
Notum G T 11: 120,654,456 H426N probably benign Het
Olfr569 T A 7: 102,887,251 I301F possibly damaging Het
Orm2 A T 4: 63,363,996 D137V probably damaging Het
Pabpc2 G A 18: 39,775,395 G571D probably damaging Het
Pabpc4 A G 4: 123,297,942 N599S probably damaging Het
Pak1ip1 T C 13: 41,012,604 V335A probably benign Het
Pcdhb11 A C 18: 37,423,393 D592A probably damaging Het
Pmch C A 10: 88,091,258 T41K possibly damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Pter G T 2: 13,000,942 G309* probably null Het
Ptprg T C 14: 12,219,024 V406A possibly damaging Het
Ranbp3l A T 15: 9,063,104 E467V possibly damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Ripk4 C T 16: 97,748,112 C248Y probably damaging Het
Slc6a15 T C 10: 103,418,053 W617R probably damaging Het
Smyd5 C T 6: 85,440,173 Q178* probably null Het
St18 T A 1: 6,803,024 F328I probably damaging Het
Supt20 T A 3: 54,703,149 L124* probably null Het
Tarbp1 T A 8: 126,447,484 H861L probably benign Het
Tars A G 15: 11,390,325 M356T probably benign Het
Tbc1d10a A G 11: 4,212,819 T221A probably damaging Het
Tead3 A G 17: 28,334,698 probably null Het
Tprg A G 16: 25,422,235 T254A probably damaging Het
Trank1 C A 9: 111,391,477 N2427K probably benign Het
Ttc30b A G 2: 75,938,242 Y56H probably damaging Het
Tufm T C 7: 126,489,864 S380P probably damaging Het
Tyrobp C T 7: 30,414,617 R68C probably damaging Het
Ubl4b T C 3: 107,554,827 E39G possibly damaging Het
Uggt2 A T 14: 119,049,451 F661I probably damaging Het
Upf3b A G X: 37,104,467 I144T probably benign Het
Usp54 A T 14: 20,561,252 D1165E probably benign Het
Vmn2r81 C T 10: 79,293,447 T724I possibly damaging Het
Vsig1 A G X: 140,936,313 I247M possibly damaging Het
Zfp110 C A 7: 12,849,260 L612I probably benign Het
Zfp318 C A 17: 46,413,296 T2075K probably damaging Het
Zfp37 A G 4: 62,191,885 M1T probably null Het
Zfp605 T A 5: 110,128,854 C613S probably damaging Het
Zfp729a G A 13: 67,621,673 P146S possibly damaging Het
Zfp85 T C 13: 67,748,672 N427S probably benign Het
Other mutations in Crot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Crot APN 5 8976072 missense probably damaging 1.00
IGL01013:Crot APN 5 8993575 missense probably benign 0.06
IGL01085:Crot APN 5 8973955 missense probably damaging 1.00
IGL02017:Crot APN 5 8970046 splice site probably benign
IGL02306:Crot APN 5 8968701 missense possibly damaging 0.94
IGL02612:Crot APN 5 8969945 missense probably damaging 1.00
IGL02884:Crot APN 5 8978197 critical splice donor site probably null
IGL03091:Crot APN 5 8966897 missense probably benign
IGL03356:Crot APN 5 8988295 splice site probably benign
ouray UTSW 5 8993504 critical splice donor site probably null
R0396:Crot UTSW 5 8969959 missense probably damaging 1.00
R0502:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0503:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0676:Crot UTSW 5 8993622 utr 5 prime probably benign
R1079:Crot UTSW 5 8993504 critical splice donor site probably null
R1472:Crot UTSW 5 8966941 missense probably damaging 1.00
R1595:Crot UTSW 5 8974186 missense probably benign 0.00
R1757:Crot UTSW 5 8987828 missense probably damaging 1.00
R1828:Crot UTSW 5 8969080 missense probably benign 0.01
R1846:Crot UTSW 5 8988248 missense probably benign 0.36
R2142:Crot UTSW 5 8987780 missense possibly damaging 0.94
R3973:Crot UTSW 5 8977541 missense probably benign
R3974:Crot UTSW 5 8977541 missense probably benign
R3975:Crot UTSW 5 8977541 missense probably benign
R4445:Crot UTSW 5 8973643 missense probably damaging 1.00
R4446:Crot UTSW 5 8973643 missense probably damaging 1.00
R4995:Crot UTSW 5 8974000 missense probably damaging 1.00
R5084:Crot UTSW 5 8969994 missense probably damaging 1.00
R5464:Crot UTSW 5 8983690 splice site probably null
R5673:Crot UTSW 5 8988131 missense probably benign 0.00
R5814:Crot UTSW 5 8973996 missense probably damaging 0.99
R5935:Crot UTSW 5 8974192 missense probably benign
R5951:Crot UTSW 5 8969120 nonsense probably null
R6862:Crot UTSW 5 8989641 missense probably damaging 0.99
R6885:Crot UTSW 5 8973635 missense probably benign 0.00
R6983:Crot UTSW 5 8978280 missense probably benign 0.06
R7150:Crot UTSW 5 8987878 missense probably damaging 0.99
R7228:Crot UTSW 5 8976051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCATCCCACATGAAGTGCC -3'
(R):5'- GCAAAAGAGGAAGGTCTCCCTGTTC -3'

Sequencing Primer
(F):5'- TCACAGATGATGTGACTGTAGCAC -3'
(R):5'- GTTCCAGAACTATTTGAGGACCC -3'
Posted On2013-04-24