Incidental Mutation 'R3957:Trim30d'
ID310756
Institutional Source Beutler Lab
Gene Symbol Trim30d
Ensembl Gene ENSMUSG00000057596
Gene Nametripartite motif-containing 30D
SynonymsTrim79, TRIM30-3
MMRRC Submission 040931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3957 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104470014-104507849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104472521 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 339 (G339D)
Ref Sequence ENSEMBL: ENSMUSP00000033211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033211] [ENSMUST00000071069]
Predicted Effect probably damaging
Transcript: ENSMUST00000033211
AA Change: G339D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033211
Gene: ENSMUSG00000057596
AA Change: G339D

DomainStartEndE-ValueType
RING 15 58 1.72e-8 SMART
BBOX 91 132 5.25e-13 SMART
low complexity region 196 228 N/A INTRINSIC
Pfam:SPRY 350 491 1.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071069
AA Change: G189D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065020
Gene: ENSMUSG00000057596
AA Change: G189D

DomainStartEndE-ValueType
coiled coil region 23 84 N/A INTRINSIC
Pfam:SPRY 198 346 1.1e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141063
AA Change: G112D
SMART Domains Protein: ENSMUSP00000115684
Gene: ENSMUSG00000057596
AA Change: G112D

DomainStartEndE-ValueType
PDB:4B3N|B 58 197 3e-19 PDB
Blast:SPRY 122 209 4e-13 BLAST
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Acsm4 A T 7: 119,703,365 M238L possibly damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Atp13a5 T A 16: 29,298,194 I579L probably benign Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Cdan1 A G 2: 120,725,632 Y718H probably damaging Het
Cdan1 G A 2: 120,731,020 probably benign Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dach1 T C 14: 97,840,109 T561A probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dhx29 C T 13: 112,930,921 A112V probably benign Het
Fanca G A 8: 123,316,363 R95C probably benign Het
Fat4 C A 3: 38,982,346 N3382K probably benign Het
Fkbp15 A C 4: 62,334,252 F290L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Ighv3-4 T A 12: 114,253,680 Q97L probably damaging Het
Igkv15-103 A T 6: 68,437,919 Y114F probably benign Het
Kera G A 10: 97,612,845 R309H probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lmx1b T C 2: 33,569,094 E149G probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Med12l T A 3: 59,073,168 S307R probably damaging Het
Mocs2 T A 13: 114,825,267 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1173 A G 2: 88,275,004 F15S probably damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Pan2 C T 10: 128,315,177 R806C probably damaging Het
Plod3 A T 5: 136,994,192 H616L probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rrnad1 T C 3: 87,926,828 K116R possibly damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdrkh A G 3: 94,428,249 N383S probably damaging Het
Trub1 G A 19: 57,485,366 A239T possibly damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Usp3 T C 9: 66,562,591 T83A probably benign Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zmym6 T C 4: 127,123,296 S957P possibly damaging Het
Zmynd8 T C 2: 165,812,475 T722A probably damaging Het
Other mutations in Trim30d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Trim30d APN 7 104472126 missense possibly damaging 0.81
IGL01818:Trim30d APN 7 104472060 missense probably damaging 1.00
IGL02552:Trim30d APN 7 104472416 missense probably damaging 0.98
IGL03000:Trim30d APN 7 104473269 missense probably benign 0.26
R0608:Trim30d UTSW 7 104472485 missense probably damaging 0.99
R0629:Trim30d UTSW 7 104487655 missense probably damaging 1.00
R1390:Trim30d UTSW 7 104483403 missense probably benign 0.41
R1460:Trim30d UTSW 7 104472104 missense probably benign 0.00
R1474:Trim30d UTSW 7 104472494 missense probably damaging 1.00
R1701:Trim30d UTSW 7 104484182 nonsense probably null
R1799:Trim30d UTSW 7 104483475 missense probably damaging 0.98
R2295:Trim30d UTSW 7 104487942 missense probably damaging 1.00
R3898:Trim30d UTSW 7 104483529 missense probably benign 0.01
R3953:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3954:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3955:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R4086:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4087:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4089:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4580:Trim30d UTSW 7 104472558 missense possibly damaging 0.68
R4596:Trim30d UTSW 7 104472526 missense probably benign 0.02
R4926:Trim30d UTSW 7 104483357 missense probably benign 0.09
R5071:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5074:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5294:Trim30d UTSW 7 104472488 missense probably damaging 1.00
R5477:Trim30d UTSW 7 104472140 missense probably damaging 1.00
R5629:Trim30d UTSW 7 104487929 missense possibly damaging 0.87
R5743:Trim30d UTSW 7 104472328 nonsense probably null
R6178:Trim30d UTSW 7 104487995 start codon destroyed probably damaging 1.00
R6244:Trim30d UTSW 7 104487610 missense probably damaging 1.00
R6937:Trim30d UTSW 7 104483427 missense probably damaging 1.00
R7014:Trim30d UTSW 7 104483336 missense probably benign 0.01
R7323:Trim30d UTSW 7 104483348 missense probably benign 0.41
X0026:Trim30d UTSW 7 104487965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACATTTAGGCTGAAACG -3'
(R):5'- GACTTTAAACAAGGCTTCTCCG -3'

Sequencing Primer
(F):5'- CATTTAGGCTGAAACGTTACATTTTG -3'
(R):5'- GCTTAAGTTACAAATAAGGCTGTACC -3'
Posted On2015-04-29