Incidental Mutation 'R3957:Tbc1d9'
ID310766
Institutional Source Beutler Lab
Gene Symbol Tbc1d9
Ensembl Gene ENSMUSG00000031709
Gene NameTBC1 domain family, member 9
Synonyms4933431N12Rik, C76116
MMRRC Submission 040931-MU
Accession Numbers

Genbank: NM_001111304.1, NM_027758.4

Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R3957 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83165352-83272934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83233532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 138 (T138I)
Ref Sequence ENSEMBL: ENSMUSP00000091093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034145] [ENSMUST00000093393]
Predicted Effect probably benign
Transcript: ENSMUST00000034145
SMART Domains Protein: ENSMUSP00000034145
Gene: ENSMUSG00000031709

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
low complexity region 192 208 N/A INTRINSIC
TBC 279 492 8.68e-56 SMART
Blast:TBC 500 587 5e-35 BLAST
PDB:1BJF|B 579 703 3e-7 PDB
low complexity region 917 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093393
AA Change: T138I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091093
Gene: ENSMUSG00000031709
AA Change: T138I

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
GRAM 146 213 1.2e-25 SMART
low complexity region 267 278 N/A INTRINSIC
GRAM 293 361 1.37e-20 SMART
low complexity region 425 441 N/A INTRINSIC
TBC 512 725 8.68e-56 SMART
Blast:TBC 733 820 6e-35 BLAST
PDB:1BJF|B 812 936 4e-7 PDB
low complexity region 1150 1170 N/A INTRINSIC
Meta Mutation Damage Score 0.0344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Acsm4 A T 7: 119,703,365 M238L possibly damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Atp13a5 T A 16: 29,298,194 I579L probably benign Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Cdan1 A G 2: 120,725,632 Y718H probably damaging Het
Cdan1 G A 2: 120,731,020 probably benign Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dach1 T C 14: 97,840,109 T561A probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dhx29 C T 13: 112,930,921 A112V probably benign Het
Fanca G A 8: 123,316,363 R95C probably benign Het
Fat4 C A 3: 38,982,346 N3382K probably benign Het
Fkbp15 A C 4: 62,334,252 F290L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Ighv3-4 T A 12: 114,253,680 Q97L probably damaging Het
Igkv15-103 A T 6: 68,437,919 Y114F probably benign Het
Kera G A 10: 97,612,845 R309H probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lmx1b T C 2: 33,569,094 E149G probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Med12l T A 3: 59,073,168 S307R probably damaging Het
Mocs2 T A 13: 114,825,267 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1173 A G 2: 88,275,004 F15S probably damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Pan2 C T 10: 128,315,177 R806C probably damaging Het
Plod3 A T 5: 136,994,192 H616L probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rrnad1 T C 3: 87,926,828 K116R possibly damaging Het
Tdrkh A G 3: 94,428,249 N383S probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Trub1 G A 19: 57,485,366 A239T possibly damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Usp3 T C 9: 66,562,591 T83A probably benign Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zmym6 T C 4: 127,123,296 S957P possibly damaging Het
Zmynd8 T C 2: 165,812,475 T722A probably damaging Het
Other mutations in Tbc1d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tbc1d9 APN 8 83234162 missense probably damaging 1.00
IGL01443:Tbc1d9 APN 8 83239931 missense probably damaging 1.00
IGL01536:Tbc1d9 APN 8 83260992 missense probably damaging 1.00
IGL01811:Tbc1d9 APN 8 83233678 missense probably damaging 1.00
IGL02068:Tbc1d9 APN 8 83239868 missense probably damaging 1.00
IGL02938:Tbc1d9 APN 8 83269067 splice site probably benign
IGL02995:Tbc1d9 APN 8 83269059 critical splice donor site probably null
IGL03127:Tbc1d9 APN 8 83249473 missense probably damaging 1.00
IGL03128:Tbc1d9 APN 8 83166085 missense probably benign 0.01
H9600:Tbc1d9 UTSW 8 83210461 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0112:Tbc1d9 UTSW 8 83264837 splice site probably benign
R0525:Tbc1d9 UTSW 8 83268985 missense probably benign 0.08
R0528:Tbc1d9 UTSW 8 83210456 missense probably damaging 1.00
R0737:Tbc1d9 UTSW 8 83259313 missense probably damaging 1.00
R1144:Tbc1d9 UTSW 8 83236571 missense possibly damaging 0.93
R1354:Tbc1d9 UTSW 8 83268981 critical splice acceptor site probably null
R1551:Tbc1d9 UTSW 8 83266158 missense probably benign 0.03
R1620:Tbc1d9 UTSW 8 83249595 missense probably damaging 1.00
R1971:Tbc1d9 UTSW 8 83249510 missense probably damaging 1.00
R1990:Tbc1d9 UTSW 8 83271303 missense probably damaging 1.00
R2082:Tbc1d9 UTSW 8 83270987 missense probably damaging 1.00
R2149:Tbc1d9 UTSW 8 83271449 missense probably damaging 1.00
R2442:Tbc1d9 UTSW 8 83166076 start codon destroyed probably null 0.08
R2920:Tbc1d9 UTSW 8 83210469 missense probably benign 0.00
R3832:Tbc1d9 UTSW 8 83233663 missense probably damaging 1.00
R3953:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3955:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3956:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R4117:Tbc1d9 UTSW 8 83266147 missense possibly damaging 0.93
R4467:Tbc1d9 UTSW 8 83210478 missense probably damaging 1.00
R4533:Tbc1d9 UTSW 8 83270918 missense probably damaging 1.00
R4568:Tbc1d9 UTSW 8 83271177 missense probably benign 0.00
R4694:Tbc1d9 UTSW 8 83234246 missense probably damaging 1.00
R4804:Tbc1d9 UTSW 8 83255925 critical splice donor site probably null
R5056:Tbc1d9 UTSW 8 83269206 missense probably benign
R5073:Tbc1d9 UTSW 8 83233547 missense probably damaging 1.00
R5122:Tbc1d9 UTSW 8 83236543 missense probably damaging 0.98
R5270:Tbc1d9 UTSW 8 83233654 missense probably benign
R5618:Tbc1d9 UTSW 8 83242592 missense probably damaging 1.00
R5738:Tbc1d9 UTSW 8 83271026 missense probably benign
R5793:Tbc1d9 UTSW 8 83271440 missense probably damaging 0.96
R5908:Tbc1d9 UTSW 8 83249545 missense probably benign 0.05
R6258:Tbc1d9 UTSW 8 83210516 missense probably damaging 1.00
R6584:Tbc1d9 UTSW 8 83261000 missense probably damaging 0.98
R6888:Tbc1d9 UTSW 8 83271588 missense possibly damaging 0.92
R6897:Tbc1d9 UTSW 8 83166180 missense probably damaging 1.00
R6969:Tbc1d9 UTSW 8 83241542 missense probably damaging 0.99
R7026:Tbc1d9 UTSW 8 83241563 missense probably benign 0.06
R7072:Tbc1d9 UTSW 8 83264865 missense probably damaging 0.97
R7099:Tbc1d9 UTSW 8 83254891 missense probably damaging 1.00
R7138:Tbc1d9 UTSW 8 83210484 missense probably damaging 1.00
X0062:Tbc1d9 UTSW 8 83233702 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AATTGGCTAGGCATGGAGGC -3'
(R):5'- TCCAAAGGTCTCAGTGAAACG -3'

Sequencing Primer
(F):5'- ACTGCATAGCTGAGTTCCAG -3'
(R):5'- GGTCTCAGTGAAACGATAGACCACTC -3'
Posted On2015-04-29