Incidental Mutation 'R3958:Glyat'
ID310822
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Nameglycine-N-acyltransferase
SynonymsA330009E03Rik
MMRRC Submission 040834-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3958 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12633308-12653911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12639833 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 16 (K16N)
Ref Sequence ENSEMBL: ENSMUSP00000043308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
Predicted Effect probably benign
Transcript: ENSMUST00000044976
AA Change: K16N

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: K16N

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119960
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157069
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A G 17: 33,433,764 K266R probably benign Het
Cebpd T C 16: 15,887,463 S47P possibly damaging Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Ckap4 C T 10: 84,528,164 R345H probably benign Het
Clasp1 T C 1: 118,467,881 V183A probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Gm6522 T C 3: 106,298,804 noncoding transcript Het
Grin1 G A 2: 25,313,453 T182M probably damaging Het
Hcn4 T C 9: 58,844,048 V319A unknown Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Hoxd8 C T 2: 74,706,540 Q18* probably null Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kmt2d G A 15: 98,855,549 T141M possibly damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Neb T C 2: 52,263,629 E2428G probably damaging Het
Nepn T C 10: 52,400,708 V119A probably benign Het
Olfr1287 G T 2: 111,449,885 L248F possibly damaging Het
Otogl T C 10: 107,821,925 D1048G probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Ppp6r3 A T 19: 3,496,583 V305D probably damaging Het
Prkg2 G T 5: 98,997,495 T160K possibly damaging Het
Prmt8 G A 6: 127,732,744 T51I probably benign Het
Rgl3 T C 9: 21,975,589 probably benign Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Selp T C 1: 164,126,286 S52P probably benign Het
Slc44a2 T C 9: 21,348,541 I615T probably damaging Het
Snap91 T C 9: 86,838,130 Y118C probably damaging Het
Tmem106b A T 6: 13,081,588 N165Y probably damaging Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Utrn T C 10: 12,750,108 I110V probably damaging Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12648133 splice site probably benign
IGL00766:Glyat APN 19 12651262 missense probably benign 0.19
IGL01288:Glyat APN 19 12650355 missense possibly damaging 0.56
IGL02296:Glyat APN 19 12651261 missense probably damaging 0.99
PIT4458001:Glyat UTSW 19 12648009 missense probably benign 0.34
R0416:Glyat UTSW 19 12651453 missense possibly damaging 0.87
R1463:Glyat UTSW 19 12648103 missense probably damaging 1.00
R1750:Glyat UTSW 19 12646315 missense probably benign 0.01
R2416:Glyat UTSW 19 12651254 missense possibly damaging 0.50
R2504:Glyat UTSW 19 12651398 missense possibly damaging 0.82
R2960:Glyat UTSW 19 12639850 missense probably damaging 1.00
R4126:Glyat UTSW 19 12651479 missense probably benign 0.03
R4561:Glyat UTSW 19 12651280 missense possibly damaging 0.88
R4705:Glyat UTSW 19 12651297 missense possibly damaging 0.68
R5062:Glyat UTSW 19 12650263 missense probably damaging 1.00
R5490:Glyat UTSW 19 12650281 missense probably benign 0.35
R7028:Glyat UTSW 19 12650359 missense probably benign 0.00
R7044:Glyat UTSW 19 12650265 missense probably benign 0.05
Z1088:Glyat UTSW 19 12648009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGATCCCTGAAAGTCTTGTGC -3'
(R):5'- GCATATTCACATACTTCAGTCACAC -3'

Sequencing Primer
(F):5'- CTTCCTTGGAGCTGGTAAGAATG -3'
(R):5'- TACTTCAGTCACACCACACCTG -3'
Posted On2015-04-29