Incidental Mutation 'R3969:Rb1cc1'
ID310862
Institutional Source Beutler Lab
Gene Symbol Rb1cc1
Ensembl Gene ENSMUSG00000025907
Gene NameRB1-inducible coiled-coil 1
SynonymsCc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200
MMRRC Submission 040937-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3969 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location6206197-6276648 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 6248270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]
Predicted Effect probably benign
Transcript: ENSMUST00000027040
SMART Domains Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 7e-4 SMART
Blast:UBQ 3 76 8e-12 BLAST
low complexity region 471 486 N/A INTRINSIC
low complexity region 643 653 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
coiled coil region 859 921 N/A INTRINSIC
low complexity region 1033 1045 N/A INTRINSIC
low complexity region 1055 1066 N/A INTRINSIC
SCOP:d1eq1a_ 1159 1305 1e-3 SMART
low complexity region 1374 1388 N/A INTRINSIC
Pfam:ATG11 1447 1583 5.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159802
Predicted Effect probably benign
Transcript: ENSMUST00000161327
SMART Domains Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
low complexity region 351 366 N/A INTRINSIC
low complexity region 523 533 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
coiled coil region 738 800 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
SCOP:d1eq1a_ 1039 1174 3e-3 SMART
low complexity region 1254 1268 N/A INTRINSIC
Pfam:ATG11 1327 1463 6.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162257
SMART Domains Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
coiled coil region 33 331 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
coiled coil region 363 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162795
SMART Domains Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 2e-4 SMART
Blast:UBQ 3 76 4e-12 BLAST
low complexity region 454 469 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
coiled coil region 842 865 N/A INTRINSIC
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,959,947 K60E probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk2d G T 3: 126,796,959 C273F possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cpeb4 T C 11: 31,872,811 I175T possibly damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Faap100 A T 11: 120,378,705 M1K probably null Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Fryl A T 5: 73,112,423 S396R probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Habp2 A G 19: 56,311,701 Y194C probably damaging Het
Irf5 A T 6: 29,536,782 Q497H probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Lins1 C T 7: 66,708,198 T27I probably benign Het
Ncstn A C 1: 172,070,009 V439G probably damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Nol8 A T 13: 49,660,016 K162* probably null Het
Olfr836 A G 9: 19,121,660 E232G probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pole3 G T 4: 62,524,961 N12K possibly damaging Het
Prl2a1 A G 13: 27,806,280 S71G probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Shroom3 T C 5: 92,940,879 V496A probably benign Het
Slc26a1 A G 5: 108,673,952 S24P probably benign Het
Tspoap1 A T 11: 87,762,446 N113Y probably damaging Het
Usp17lc A T 7: 103,418,419 H307L probably damaging Het
Vmn2r79 T C 7: 87,003,593 W498R probably damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Wwc2 T C 8: 47,856,323 D808G unknown Het
Ybx2 G A 11: 69,940,416 R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 S308F probably damaging Het
Other mutations in Rb1cc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Rb1cc1 APN 1 6249506 missense probably damaging 0.97
IGL00590:Rb1cc1 APN 1 6238296 missense probably damaging 1.00
IGL00678:Rb1cc1 APN 1 6234085 missense probably damaging 1.00
IGL00705:Rb1cc1 APN 1 6244133 missense probably benign 0.00
IGL00957:Rb1cc1 APN 1 6249539 missense probably damaging 1.00
IGL01363:Rb1cc1 APN 1 6250109 missense probably benign 0.06
IGL01599:Rb1cc1 APN 1 6248771 nonsense probably null
IGL01610:Rb1cc1 APN 1 6248481 missense probably benign 0.03
IGL01929:Rb1cc1 APN 1 6240159 missense possibly damaging 0.82
IGL01978:Rb1cc1 APN 1 6238368 missense probably damaging 1.00
IGL02312:Rb1cc1 APN 1 6265623 critical splice donor site probably null
IGL02471:Rb1cc1 APN 1 6240051 missense probably benign 0.01
IGL02677:Rb1cc1 APN 1 6249419 missense probably benign
IGL02702:Rb1cc1 APN 1 6240023 missense probably damaging 0.99
IGL02816:Rb1cc1 APN 1 6262828 splice site probably benign
IGL02899:Rb1cc1 APN 1 6264583 missense probably damaging 1.00
IGL02988:Rb1cc1 UTSW 1 6247811 critical splice donor site probably null
R0020:Rb1cc1 UTSW 1 6264548 missense possibly damaging 0.86
R0254:Rb1cc1 UTSW 1 6262847 missense probably damaging 1.00
R0390:Rb1cc1 UTSW 1 6248634 missense probably damaging 1.00
R0466:Rb1cc1 UTSW 1 6263267 splice site probably null
R0482:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R0510:Rb1cc1 UTSW 1 6249171 missense probably benign 0.00
R0512:Rb1cc1 UTSW 1 6248543 missense probably damaging 1.00
R0616:Rb1cc1 UTSW 1 6244262 missense possibly damaging 0.80
R0617:Rb1cc1 UTSW 1 6248790 missense possibly damaging 0.83
R0837:Rb1cc1 UTSW 1 6234271 unclassified probably null
R1399:Rb1cc1 UTSW 1 6249818 missense probably benign 0.00
R1532:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R1542:Rb1cc1 UTSW 1 6244249 missense possibly damaging 0.82
R1746:Rb1cc1 UTSW 1 6263013 splice site probably null
R1764:Rb1cc1 UTSW 1 6214680 intron probably benign
R1968:Rb1cc1 UTSW 1 6248195 splice site probably null
R2025:Rb1cc1 UTSW 1 6245309 missense probably damaging 1.00
R2076:Rb1cc1 UTSW 1 6250038 missense possibly damaging 0.82
R2101:Rb1cc1 UTSW 1 6249335 missense probably benign
R2249:Rb1cc1 UTSW 1 6272724 missense probably damaging 1.00
R3176:Rb1cc1 UTSW 1 6249366 missense probably benign
R3276:Rb1cc1 UTSW 1 6249366 missense probably benign
R3716:Rb1cc1 UTSW 1 6270690 critical splice acceptor site probably null
R3747:Rb1cc1 UTSW 1 6248742 missense possibly damaging 0.92
R3850:Rb1cc1 UTSW 1 6250113 missense probably benign 0.22
R3967:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3972:Rb1cc1 UTSW 1 6249000 missense probably benign 0.00
R4166:Rb1cc1 UTSW 1 6265663 intron probably benign
R4168:Rb1cc1 UTSW 1 6230024 missense probably damaging 1.00
R4358:Rb1cc1 UTSW 1 6245637 missense probably damaging 0.99
R4370:Rb1cc1 UTSW 1 6248547 missense probably damaging 1.00
R4869:Rb1cc1 UTSW 1 6215021 intron probably benign
R4945:Rb1cc1 UTSW 1 6249627 missense probably benign 0.24
R5111:Rb1cc1 UTSW 1 6214634 intron probably benign
R5175:Rb1cc1 UTSW 1 6248321 missense probably benign
R5196:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R5271:Rb1cc1 UTSW 1 6249193 nonsense probably null
R5341:Rb1cc1 UTSW 1 6215042 intron probably benign
R5952:Rb1cc1 UTSW 1 6248182 missense probably benign
R5992:Rb1cc1 UTSW 1 6233996 missense probably damaging 1.00
R6054:Rb1cc1 UTSW 1 6249834 missense probably benign 0.01
R6064:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R6313:Rb1cc1 UTSW 1 6244133 missense probably benign 0.00
R6345:Rb1cc1 UTSW 1 6263257 missense probably benign 0.00
R6488:Rb1cc1 UTSW 1 6270727 missense probably damaging 0.97
R6566:Rb1cc1 UTSW 1 6249092 missense probably benign 0.15
R6739:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R6829:Rb1cc1 UTSW 1 6249264 missense probably benign 0.04
R6945:Rb1cc1 UTSW 1 6261032 missense probably damaging 1.00
R6976:Rb1cc1 UTSW 1 6262902 missense probably benign 0.01
R7031:Rb1cc1 UTSW 1 6238466 critical splice donor site probably null
R7066:Rb1cc1 UTSW 1 6250005 missense possibly damaging 0.69
Z1088:Rb1cc1 UTSW 1 6249018 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TACACCAGCATGTACTTGCC -3'
(R):5'- GAAGCTTGGTGAACAGGTTG -3'

Sequencing Primer
(F):5'- GCATGTACTTGCCCTACATAATTTGG -3'
(R):5'- GTATGAGCATCGATACTATCTGGAG -3'
Posted On2015-04-29