Incidental Mutation 'R3969:Ncstn'
ID 310864
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Name nicastrin
Synonyms D1Dau13e, 9430068N19Rik, Nct, nicastrin
MMRRC Submission 040937-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3969 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171893580-171910356 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 171897576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 439 (V439G)
Ref Sequence ENSEMBL: ENSMUSP00000003550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]
AlphaFold P57716
Predicted Effect probably damaging
Transcript: ENSMUST00000003550
AA Change: V439G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: V439G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135928
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Meta Mutation Damage Score 0.9442 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,835,846 (GRCm39) K60E probably damaging Het
Arhgef12 C A 9: 42,916,847 (GRCm39) R432L probably damaging Het
Armcx6 G T X: 133,650,505 (GRCm39) H109N possibly damaging Het
Camk2d G T 3: 126,590,608 (GRCm39) C273F possibly damaging Het
Camk4 T A 18: 33,312,634 (GRCm39) I258N possibly damaging Het
Chia1 T G 3: 106,028,951 (GRCm39) probably null Het
Commd9 C A 2: 101,727,486 (GRCm39) N93K probably benign Het
Cpeb4 T C 11: 31,822,811 (GRCm39) I175T possibly damaging Het
Dnah17 G A 11: 117,931,984 (GRCm39) probably benign Het
E2f1 C G 2: 154,405,942 (GRCm39) G144R probably damaging Het
Faap100 A T 11: 120,269,531 (GRCm39) M1K probably null Het
Flna A T X: 73,279,273 (GRCm39) V1253E probably damaging Het
Fryl A T 5: 73,269,766 (GRCm39) S396R probably damaging Het
Gm12185 A T 11: 48,798,172 (GRCm39) C774S probably benign Het
Habp2 A G 19: 56,300,133 (GRCm39) Y194C probably damaging Het
Insyn2b A T 11: 34,369,739 (GRCm39) Q481L probably damaging Het
Irf5 A T 6: 29,536,781 (GRCm39) Q497H probably benign Het
Lama3 A T 18: 12,713,398 (GRCm39) K3230M probably damaging Het
Lins1 C T 7: 66,357,946 (GRCm39) T27I probably benign Het
Nlrx1 A T 9: 44,166,722 (GRCm39) probably benign Het
Nol8 A T 13: 49,813,492 (GRCm39) K162* probably null Het
Or7g21 A G 9: 19,032,956 (GRCm39) E232G probably benign Het
Or8b54 A G 9: 38,686,664 (GRCm39) T38A probably benign Het
Pabpc5 A G X: 118,838,321 (GRCm39) E212G probably benign Het
Pecr G A 1: 72,315,468 (GRCm39) T94I probably damaging Het
Piezo2 A T 18: 63,144,767 (GRCm39) V2776E probably damaging Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Pole3 G T 4: 62,443,198 (GRCm39) N12K possibly damaging Het
Prl2a1 A G 13: 27,990,263 (GRCm39) S71G probably benign Het
Rab39 G A 9: 53,597,932 (GRCm39) A111V possibly damaging Het
Rb1cc1 T A 1: 6,318,494 (GRCm39) probably benign Het
Shroom3 T C 5: 93,088,738 (GRCm39) V496A probably benign Het
Slc26a1 A G 5: 108,821,818 (GRCm39) S24P probably benign Het
Tspoap1 A T 11: 87,653,272 (GRCm39) N113Y probably damaging Het
Usp17lc A T 7: 103,067,626 (GRCm39) H307L probably damaging Het
Vmn2r79 T C 7: 86,652,801 (GRCm39) W498R probably damaging Het
Vmn2r94 C A 17: 18,478,647 (GRCm39) Q33H possibly damaging Het
Wwc2 T C 8: 48,309,358 (GRCm39) D808G unknown Het
Ybx2 G A 11: 69,831,242 (GRCm39) R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 (GRCm39) S308F probably damaging Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 171,901,968 (GRCm39) missense probably benign 0.02
IGL02030:Ncstn APN 1 171,900,024 (GRCm39) splice site probably benign
IGL02470:Ncstn APN 1 171,910,166 (GRCm39) critical splice donor site probably null
IGL02498:Ncstn APN 1 171,896,159 (GRCm39) missense probably benign
morel UTSW 1 171,900,043 (GRCm39) missense probably damaging 0.99
Pig UTSW 1 171,899,092 (GRCm39) missense probably damaging 1.00
truffle UTSW 1 171,897,576 (GRCm39) missense probably damaging 1.00
R0048:Ncstn UTSW 1 171,897,528 (GRCm39) splice site probably benign
R0480:Ncstn UTSW 1 171,910,159 (GRCm39) splice site probably benign
R0648:Ncstn UTSW 1 171,895,454 (GRCm39) missense probably benign 0.01
R0792:Ncstn UTSW 1 171,899,072 (GRCm39) missense possibly damaging 0.95
R1330:Ncstn UTSW 1 171,899,092 (GRCm39) missense probably damaging 1.00
R1524:Ncstn UTSW 1 171,899,716 (GRCm39) missense possibly damaging 0.58
R1660:Ncstn UTSW 1 171,894,339 (GRCm39) missense possibly damaging 0.78
R1828:Ncstn UTSW 1 171,899,038 (GRCm39) frame shift probably null
R1892:Ncstn UTSW 1 171,899,038 (GRCm39) frame shift probably null
R1907:Ncstn UTSW 1 171,899,710 (GRCm39) missense probably damaging 0.97
R3722:Ncstn UTSW 1 171,895,462 (GRCm39) missense possibly damaging 0.50
R3876:Ncstn UTSW 1 171,897,640 (GRCm39) missense probably benign 0.02
R3946:Ncstn UTSW 1 171,895,061 (GRCm39) missense probably benign 0.00
R4108:Ncstn UTSW 1 171,900,111 (GRCm39) missense probably damaging 1.00
R4597:Ncstn UTSW 1 171,895,823 (GRCm39) nonsense probably null
R4998:Ncstn UTSW 1 171,899,087 (GRCm39) missense possibly damaging 0.81
R5037:Ncstn UTSW 1 171,896,193 (GRCm39) missense probably damaging 1.00
R5150:Ncstn UTSW 1 171,895,151 (GRCm39) intron probably benign
R5406:Ncstn UTSW 1 171,899,731 (GRCm39) missense probably benign 0.00
R5444:Ncstn UTSW 1 171,900,406 (GRCm39) missense possibly damaging 0.92
R5605:Ncstn UTSW 1 171,908,717 (GRCm39) intron probably benign
R6675:Ncstn UTSW 1 171,899,095 (GRCm39) missense probably damaging 1.00
R7268:Ncstn UTSW 1 171,908,830 (GRCm39) missense possibly damaging 0.86
R7290:Ncstn UTSW 1 171,900,373 (GRCm39) missense probably benign
R7871:Ncstn UTSW 1 171,903,023 (GRCm39) missense probably benign 0.00
R8238:Ncstn UTSW 1 171,900,043 (GRCm39) missense probably damaging 0.99
R9462:Ncstn UTSW 1 171,899,707 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCGGCTATTACAGGAAGAATCC -3'
(R):5'- TTGAAGACTGTCTAGGAGAGCG -3'

Sequencing Primer
(F):5'- AGAATCCAAACTTCCTGGGAG -3'
(R):5'- TACTGAGAGCCCTCCTGC -3'
Posted On 2015-04-29