Incidental Mutation 'R3969:Nol8'
ID310893
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Namenucleolar protein 8
Synonyms5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission 040937-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3969 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49653078-49679016 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 49660016 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 162 (K162*)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000021824] [ENSMUST00000021824] [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467] [ENSMUST00000223467]
Predicted Effect probably null
Transcript: ENSMUST00000021824
AA Change: K180*
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: K180*

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021824
AA Change: K180*
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: K180*

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021824
AA Change: K180*
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: K180*

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021824
AA Change: K180*
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: K180*

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221083
AA Change: K162*
Predicted Effect probably null
Transcript: ENSMUST00000221083
AA Change: K162*
Predicted Effect probably null
Transcript: ENSMUST00000221142
AA Change: K162*
Predicted Effect probably null
Transcript: ENSMUST00000221142
AA Change: K162*
Predicted Effect probably null
Transcript: ENSMUST00000222197
AA Change: K180*
Predicted Effect probably null
Transcript: ENSMUST00000222197
AA Change: K180*
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect probably benign
Transcript: ENSMUST00000223264
Predicted Effect probably null
Transcript: ENSMUST00000223467
AA Change: K162*
Predicted Effect probably null
Transcript: ENSMUST00000223467
AA Change: K162*
Meta Mutation Damage Score 0.592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,959,947 K60E probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk2d G T 3: 126,796,959 C273F possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cpeb4 T C 11: 31,872,811 I175T possibly damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Faap100 A T 11: 120,378,705 M1K probably null Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Fryl A T 5: 73,112,423 S396R probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Habp2 A G 19: 56,311,701 Y194C probably damaging Het
Irf5 A T 6: 29,536,782 Q497H probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Lins1 C T 7: 66,708,198 T27I probably benign Het
Ncstn A C 1: 172,070,009 V439G probably damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr836 A G 9: 19,121,660 E232G probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pole3 G T 4: 62,524,961 N12K possibly damaging Het
Prl2a1 A G 13: 27,806,280 S71G probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Shroom3 T C 5: 92,940,879 V496A probably benign Het
Slc26a1 A G 5: 108,673,952 S24P probably benign Het
Tspoap1 A T 11: 87,762,446 N113Y probably damaging Het
Usp17lc A T 7: 103,418,419 H307L probably damaging Het
Vmn2r79 T C 7: 87,003,593 W498R probably damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Wwc2 T C 8: 47,856,323 D808G unknown Het
Ybx2 G A 11: 69,940,416 R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 S308F probably damaging Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACTTTAATAGTAGTCCATTGTGAGC -3'
(R):5'- TGGCATTCATAATTTGTACCACCC -3'

Sequencing Primer
(F):5'- AGTAGTCCATTGTGAGCTCAAC -3'
(R):5'- TTCATAATTTGTACCACCCAACTAC -3'
Posted On2015-04-29