Incidental Mutation 'R3969:Camk4'
ID310897
Institutional Source Beutler Lab
Gene Symbol Camk4
Ensembl Gene ENSMUSG00000038128
Gene Namecalcium/calmodulin-dependent protein kinase IV
SynonymsD18Bwg0362e, CaMKIV/Gr, CaMKIV, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik
MMRRC Submission 040937-MU
Accession Numbers

Genbank: NM_009793; MGI: 88258

Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R3969 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32939041-33195767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33179581 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 258 (I258N)
Ref Sequence ENSEMBL: ENSMUSP00000046539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042868
AA Change: I258N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046539
Gene: ENSMUSG00000038128
AA Change: I258N

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
S_TKc 42 296 8.7e-106 SMART
low complexity region 318 344 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for different targeted mutations show variable phenotypes, including reduced viability, male and/or female sterility, and mild to severe neurological and spatial memory disorders. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(3) Targeted, other(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,959,947 K60E probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk2d G T 3: 126,796,959 C273F possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cpeb4 T C 11: 31,872,811 I175T possibly damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Faap100 A T 11: 120,378,705 M1K probably null Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Fryl A T 5: 73,112,423 S396R probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Habp2 A G 19: 56,311,701 Y194C probably damaging Het
Irf5 A T 6: 29,536,782 Q497H probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Lins1 C T 7: 66,708,198 T27I probably benign Het
Ncstn A C 1: 172,070,009 V439G probably damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Nol8 A T 13: 49,660,016 K162* probably null Het
Olfr836 A G 9: 19,121,660 E232G probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pole3 G T 4: 62,524,961 N12K possibly damaging Het
Prl2a1 A G 13: 27,806,280 S71G probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Shroom3 T C 5: 92,940,879 V496A probably benign Het
Slc26a1 A G 5: 108,673,952 S24P probably benign Het
Tspoap1 A T 11: 87,762,446 N113Y probably damaging Het
Usp17lc A T 7: 103,418,419 H307L probably damaging Het
Vmn2r79 T C 7: 87,003,593 W498R probably damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Wwc2 T C 8: 47,856,323 D808G unknown Het
Ybx2 G A 11: 69,940,416 R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 S308F probably damaging Het
Other mutations in Camk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
7510:Camk4 UTSW 18 33156839 missense probably null 0.99
R0244:Camk4 UTSW 18 33179625 critical splice donor site probably null
R0408:Camk4 UTSW 18 33129792 missense probably damaging 1.00
R0744:Camk4 UTSW 18 32939454 missense unknown
R0836:Camk4 UTSW 18 32939454 missense unknown
R0903:Camk4 UTSW 18 33182330 missense probably benign 0.08
R1449:Camk4 UTSW 18 32939475 missense probably damaging 0.99
R1456:Camk4 UTSW 18 33129843 splice site probably benign
R1677:Camk4 UTSW 18 33176222 missense probably damaging 1.00
R1733:Camk4 UTSW 18 33078021 missense possibly damaging 0.54
R1909:Camk4 UTSW 18 33158816 splice site probably null
R2186:Camk4 UTSW 18 33182341 missense probably damaging 0.99
R2291:Camk4 UTSW 18 33107943 critical splice donor site probably null
R3874:Camk4 UTSW 18 33158854 missense possibly damaging 0.70
R3968:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3970:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R4858:Camk4 UTSW 18 33176213 missense probably damaging 0.98
R5251:Camk4 UTSW 18 33184879 missense probably benign 0.31
R5343:Camk4 UTSW 18 33078069 missense probably damaging 0.99
R5972:Camk4 UTSW 18 33107926 missense probably damaging 1.00
R6155:Camk4 UTSW 18 32939447 missense unknown
R6728:Camk4 UTSW 18 33184939 missense probably benign
R7088:Camk4 UTSW 18 32939531 missense probably benign 0.02
R7135:Camk4 UTSW 18 33107943 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAATTGCACACCTGTACAAGTAG -3'
(R):5'- GTTTCTGTTCTGCATAAGGAAGATG -3'

Sequencing Primer
(F):5'- GCACACCTGTACAAGTAGATTTAC -3'
(R):5'- AAGGAAGATGCATTAATTTAATGTGC -3'
Posted On2015-04-29