Incidental Mutation 'R3969:Armcx6'
ID310902
Institutional Source Beutler Lab
Gene Symbol Armcx6
Ensembl Gene ENSMUSG00000050394
Gene Namearmadillo repeat containing, X-linked 6
Synonyms
MMRRC Submission 040937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R3969 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location134748461-134751417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 134749756 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 109 (H109N)
Ref Sequence ENSEMBL: ENSMUSP00000108819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052431] [ENSMUST00000113194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052431
AA Change: H109N

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057277
Gene: ENSMUSG00000050394
AA Change: H109N

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
Pfam:Arm_2 105 300 7.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113194
AA Change: H109N

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108819
Gene: ENSMUSG00000050394
AA Change: H109N

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
Pfam:Arm_2 105 300 3.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193498
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,959,947 K60E probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk2d G T 3: 126,796,959 C273F possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cpeb4 T C 11: 31,872,811 I175T possibly damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Faap100 A T 11: 120,378,705 M1K probably null Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Fryl A T 5: 73,112,423 S396R probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Habp2 A G 19: 56,311,701 Y194C probably damaging Het
Irf5 A T 6: 29,536,782 Q497H probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Lins1 C T 7: 66,708,198 T27I probably benign Het
Ncstn A C 1: 172,070,009 V439G probably damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Nol8 A T 13: 49,660,016 K162* probably null Het
Olfr836 A G 9: 19,121,660 E232G probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pole3 G T 4: 62,524,961 N12K possibly damaging Het
Prl2a1 A G 13: 27,806,280 S71G probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Shroom3 T C 5: 92,940,879 V496A probably benign Het
Slc26a1 A G 5: 108,673,952 S24P probably benign Het
Tspoap1 A T 11: 87,762,446 N113Y probably damaging Het
Usp17lc A T 7: 103,418,419 H307L probably damaging Het
Vmn2r79 T C 7: 87,003,593 W498R probably damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Wwc2 T C 8: 47,856,323 D808G unknown Het
Ybx2 G A 11: 69,940,416 R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 S308F probably damaging Het
Other mutations in Armcx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2906:Armcx6 UTSW X 134749450 missense probably damaging 1.00
R2907:Armcx6 UTSW X 134749450 missense probably damaging 1.00
R2939:Armcx6 UTSW X 134749876 missense probably damaging 1.00
R2940:Armcx6 UTSW X 134749876 missense probably damaging 1.00
R3967:Armcx6 UTSW X 134749756 missense possibly damaging 0.77
R3970:Armcx6 UTSW X 134749756 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCAACCACTGATAGGCTGG -3'
(R):5'- CTGCATGTACAAACTGACCATG -3'

Sequencing Primer
(F):5'- ACTGATAGGCTGGCCAGATGTTTAC -3'
(R):5'- CATGTACAAACTGACCATGGGAAG -3'
Posted On2015-04-29