Incidental Mutation 'R3970:E2f1'
ID 310910
Institutional Source Beutler Lab
Gene Symbol E2f1
Ensembl Gene ENSMUSG00000027490
Gene Name E2F transcription factor 1
Synonyms E2F-1
MMRRC Submission 040938-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.858) question?
Stock # R3970 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 154401327-154411812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 154405942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 144 (G144R)
Ref Sequence ENSEMBL: ENSMUSP00000099434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000894] [ENSMUST00000103145]
AlphaFold Q61501
Predicted Effect probably damaging
Transcript: ENSMUST00000000894
AA Change: G99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000894
Gene: ENSMUSG00000027490
AA Change: G99R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:E2F_TDP 77 142 1.1e-25 PFAM
low complexity region 156 173 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103145
AA Change: G144R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099434
Gene: ENSMUSG00000027490
AA Change: G144R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
E2F_TDP 122 187 1.63e-30 SMART
Pfam:E2F_CC-MB 201 294 2.2e-37 PFAM
low complexity region 318 340 N/A INTRINSIC
Meta Mutation Damage Score 0.6284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show defective T lymphocyte development, impaired pancreatic growth and beta cell function, altered glucose homeostasis, testicular atrophy, salivary gland and adipose tissue defects, and increased tumor induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,779 (GRCm39) M583T probably damaging Het
Actn4 T C 7: 28,661,457 (GRCm39) K51R probably benign Het
Adamts15 T C 9: 30,821,898 (GRCm39) Y513C probably benign Het
Akap13 T A 7: 75,219,699 (GRCm39) L34* probably null Het
Akap6 A T 12: 53,188,236 (GRCm39) K1883N probably damaging Het
Ano1 T C 7: 144,161,700 (GRCm39) N749D probably benign Het
Armcx6 G T X: 133,650,505 (GRCm39) H109N possibly damaging Het
Camk4 T A 18: 33,312,634 (GRCm39) I258N possibly damaging Het
Cdhr2 A T 13: 54,874,271 (GRCm39) N781I probably damaging Het
Cherp T C 8: 73,223,795 (GRCm39) H196R possibly damaging Het
Chia1 T G 3: 106,028,951 (GRCm39) probably null Het
Col11a1 A T 3: 113,890,838 (GRCm39) T392S unknown Het
Commd9 C A 2: 101,727,486 (GRCm39) N93K probably benign Het
Csf2rb T C 15: 78,225,667 (GRCm39) V286A probably benign Het
Dnah17 G A 11: 117,931,984 (GRCm39) probably benign Het
Fcho2 A T 13: 98,871,564 (GRCm39) S551T probably benign Het
Flna A T X: 73,279,273 (GRCm39) V1253E probably damaging Het
Gm12185 A T 11: 48,798,172 (GRCm39) C774S probably benign Het
Gm14401 T C 2: 176,778,789 (GRCm39) Y292H possibly damaging Het
Insyn2b A T 11: 34,369,739 (GRCm39) Q481L probably damaging Het
Kif5c A G 2: 49,578,756 (GRCm39) E128G probably damaging Het
Lama3 A T 18: 12,713,398 (GRCm39) K3230M probably damaging Het
Myof C T 19: 37,889,711 (GRCm39) V1287M probably damaging Het
Myof T G 19: 38,011,058 (GRCm39) D60A possibly damaging Het
Myrf A G 19: 10,200,601 (GRCm39) L332P probably damaging Het
Nampt T A 12: 32,883,095 (GRCm39) D93E probably benign Het
Narf A T 11: 121,129,247 (GRCm39) E10D possibly damaging Het
Nlrp6 C A 7: 140,501,568 (GRCm39) A45E probably damaging Het
Obscn G A 11: 58,942,488 (GRCm39) P4898L probably damaging Het
Or8c11 T C 9: 38,289,222 (GRCm39) V15A probably damaging Het
Pabpc5 A G X: 118,838,321 (GRCm39) E212G probably benign Het
Pcdh8 C T 14: 80,007,706 (GRCm39) G286S possibly damaging Het
Pcdha2 C A 18: 37,073,750 (GRCm39) Y460* probably null Het
Pcdhga4 G T 18: 37,820,654 (GRCm39) L734F possibly damaging Het
Pecr G A 1: 72,315,468 (GRCm39) T94I probably damaging Het
Piezo2 A T 18: 63,144,767 (GRCm39) V2776E probably damaging Het
Pign A C 1: 105,583,728 (GRCm39) S125A probably damaging Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Pkd1l1 C T 11: 8,824,218 (GRCm39) E1566K probably damaging Het
Plcb2 A G 2: 118,546,171 (GRCm39) probably benign Het
Ppl T C 16: 4,918,196 (GRCm39) probably null Het
Pramel4 A T 4: 143,795,044 (GRCm39) N477I possibly damaging Het
Psd C T 19: 46,312,845 (GRCm39) R175H probably benign Het
Sema3g T C 14: 30,948,478 (GRCm39) probably null Het
Sf3b1 G A 1: 55,051,341 (GRCm39) R196* probably null Het
Slc26a4 G T 12: 31,578,686 (GRCm39) H656N probably damaging Het
Slc6a7 A C 18: 61,136,417 (GRCm39) L328R possibly damaging Het
Stab2 T C 10: 86,714,750 (GRCm39) T139A probably damaging Het
Tiam2 T A 17: 3,479,106 (GRCm39) I613N probably damaging Het
Tlk1 A G 2: 70,546,996 (GRCm39) V695A probably damaging Het
Trpc2 A G 7: 101,733,531 (GRCm39) D160G probably damaging Het
Uhrf2 T C 19: 30,057,315 (GRCm39) V491A probably damaging Het
Vwa7 G A 17: 35,236,684 (GRCm39) A84T probably damaging Het
Zfp219 T A 14: 52,244,421 (GRCm39) Q541L probably benign Het
Other mutations in E2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0666:E2f1 UTSW 2 154,402,849 (GRCm39) missense probably benign 0.01
R0674:E2f1 UTSW 2 154,406,029 (GRCm39) missense probably damaging 1.00
R1796:E2f1 UTSW 2 154,402,849 (GRCm39) missense probably benign 0.02
R3747:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3751:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3752:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3753:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3843:E2f1 UTSW 2 154,402,748 (GRCm39) missense probably benign 0.00
R3844:E2f1 UTSW 2 154,402,748 (GRCm39) missense probably benign 0.00
R3968:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3969:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R4409:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R4700:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R5396:E2f1 UTSW 2 154,406,368 (GRCm39) missense probably benign 0.00
R5666:E2f1 UTSW 2 154,411,101 (GRCm39) intron probably benign
R6368:E2f1 UTSW 2 154,406,396 (GRCm39) missense possibly damaging 0.81
R9348:E2f1 UTSW 2 154,402,755 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGACCTTGGTTTCCCAGCTG -3'
(R):5'- TACATTGCTAGGGAGACAGGC -3'

Sequencing Primer
(F):5'- GCCACTGCAAGCAATTTGG -3'
(R):5'- CTAGGGAGACAGGCCTGTTG -3'
Posted On 2015-04-29