Incidental Mutation 'R3970:Col11a1'
ID310913
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Namecollagen, type XI, alpha 1
SynonymsC530001D20Rik
MMRRC Submission 040938-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R3970 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location114030540-114220718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114097189 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 392 (T392S)
Ref Sequence ENSEMBL: ENSMUSP00000089793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000123619]
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: T392S
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: T392S

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123619
AA Change: T404S
SMART Domains Protein: ENSMUSP00000121027
Gene: ENSMUSG00000027966
AA Change: T404S

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 259 296 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Pfam:Collagen 446 503 6.9e-10 PFAM
low complexity region 521 538 N/A INTRINSIC
low complexity region 545 566 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,322 M583T probably damaging Het
Actn4 T C 7: 28,962,032 K51R probably benign Het
Adamts15 T C 9: 30,910,602 Y513C probably benign Het
Akap13 T A 7: 75,569,951 L34* probably null Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Ano1 T C 7: 144,607,963 N749D probably benign Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cherp T C 8: 72,469,951 H196R possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Csf2rb T C 15: 78,341,467 V286A probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Kif5c A G 2: 49,688,744 E128G probably damaging Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Myrf A G 19: 10,223,237 L332P probably damaging Het
Nampt T A 12: 32,833,096 D93E probably benign Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrp6 C A 7: 140,921,655 A45E probably damaging Het
Obscn G A 11: 59,051,662 P4898L probably damaging Het
Olfr251 T C 9: 38,377,926 V15A probably damaging Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pcdh8 C T 14: 79,770,266 G286S possibly damaging Het
Pcdha2 C A 18: 36,940,697 Y460* probably null Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pign A C 1: 105,656,003 S125A probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkd1l1 C T 11: 8,874,218 E1566K probably damaging Het
Plcb2 A G 2: 118,715,690 probably benign Het
Ppl T C 16: 5,100,332 probably null Het
Pramel4 A T 4: 144,068,474 N477I possibly damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Sema3g T C 14: 31,226,521 probably null Het
Sf3b1 G A 1: 55,012,182 R196* probably null Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc6a7 A C 18: 61,003,345 L328R possibly damaging Het
Stab2 T C 10: 86,878,886 T139A probably damaging Het
Tiam2 T A 17: 3,428,831 I613N probably damaging Het
Tlk1 A G 2: 70,716,652 V695A probably damaging Het
Trpc2 A G 7: 102,084,324 D160G probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Vwa7 G A 17: 35,017,708 A84T probably damaging Het
Zfp219 T A 14: 52,006,964 Q541L probably benign Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 114066533 missense unknown
IGL00578:Col11a1 APN 3 114194106 missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 114124315 missense unknown
IGL01014:Col11a1 APN 3 114123809 splice site probably benign
IGL01099:Col11a1 APN 3 114112041 nonsense probably null
IGL01129:Col11a1 APN 3 114185873 splice site probably benign
IGL01474:Col11a1 APN 3 114217134 utr 3 prime probably benign
IGL01884:Col11a1 APN 3 114066542 missense unknown
IGL02104:Col11a1 APN 3 114181397 critical splice donor site probably null
IGL02715:Col11a1 APN 3 114129409 missense probably benign 0.06
IGL02978:Col11a1 APN 3 114061562 missense unknown
IGL03203:Col11a1 APN 3 114212084 missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114217210 splice site probably null
IGL03357:Col11a1 APN 3 114194091 missense probably damaging 1.00
IGL03390:Col11a1 APN 3 114090253 missense unknown
gluon UTSW 3 114217170 utr 3 prime probably benign
uncovered UTSW 3 114112467 unclassified probably benign
R0110:Col11a1 UTSW 3 114105456 splice site probably benign
R0144:Col11a1 UTSW 3 114113594 missense unknown
R0432:Col11a1 UTSW 3 114205901 splice site probably benign
R0468:Col11a1 UTSW 3 114217058 utr 3 prime probably benign
R0510:Col11a1 UTSW 3 114105456 splice site probably benign
R0535:Col11a1 UTSW 3 114061535 missense unknown
R0608:Col11a1 UTSW 3 114218715 utr 3 prime probably benign
R0826:Col11a1 UTSW 3 114138765 missense unknown
R0827:Col11a1 UTSW 3 114138765 missense unknown
R0862:Col11a1 UTSW 3 114138765 missense unknown
R0863:Col11a1 UTSW 3 114138765 missense unknown
R0926:Col11a1 UTSW 3 114090180 missense unknown
R0980:Col11a1 UTSW 3 114138765 missense unknown
R0981:Col11a1 UTSW 3 114138765 missense unknown
R1004:Col11a1 UTSW 3 114095022 splice site probably benign
R1037:Col11a1 UTSW 3 114194152 missense probably damaging 1.00
R1171:Col11a1 UTSW 3 114066564 missense unknown
R1316:Col11a1 UTSW 3 114138970 splice site probably null
R1324:Col11a1 UTSW 3 114030916 missense unknown
R1338:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1513:Col11a1 UTSW 3 114097154 missense unknown
R1528:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1567:Col11a1 UTSW 3 114138612 missense unknown
R1596:Col11a1 UTSW 3 114152613 utr 3 prime probably benign
R1605:Col11a1 UTSW 3 114131641 missense probably damaging 1.00
R1624:Col11a1 UTSW 3 114158155 missense probably damaging 0.97
R1626:Col11a1 UTSW 3 114131569 missense probably damaging 1.00
R1666:Col11a1 UTSW 3 114061535 missense unknown
R1806:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2001:Col11a1 UTSW 3 114165293 splice site probably null
R2084:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2085:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R3926:Col11a1 UTSW 3 114090124 splice site probably benign
R3950:Col11a1 UTSW 3 114121445 critical splice donor site probably null
R4171:Col11a1 UTSW 3 114208214 missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 114108316 missense unknown
R4540:Col11a1 UTSW 3 114097166 missense unknown
R5210:Col11a1 UTSW 3 114153157 missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114217170 utr 3 prime probably benign
R5335:Col11a1 UTSW 3 114095240 missense unknown
R5344:Col11a1 UTSW 3 114208362 critical splice donor site probably null
R5394:Col11a1 UTSW 3 114194184 splice site probably null
R5687:Col11a1 UTSW 3 114217103 utr 3 prime probably benign
R5708:Col11a1 UTSW 3 114097094 missense unknown
R5763:Col11a1 UTSW 3 114094596 intron probably benign
R5792:Col11a1 UTSW 3 114131593 missense probably damaging 1.00
R6259:Col11a1 UTSW 3 114138447 missense probably benign
R6679:Col11a1 UTSW 3 114152719 splice site probably null
R6738:Col11a1 UTSW 3 114112467 unclassified probably benign
R6747:Col11a1 UTSW 3 114212450 nonsense probably null
R6808:Col11a1 UTSW 3 114094944 missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 114167492 missense probably damaging 1.00
R7201:Col11a1 UTSW 3 114090157 missense unknown
R7264:Col11a1 UTSW 3 114185599 missense unknown
R7393:Col11a1 UTSW 3 114097106 missense unknown
R7445:Col11a1 UTSW 3 114193929 missense unknown
R7479:Col11a1 UTSW 3 114102569 missense unknown
R7548:Col11a1 UTSW 3 114123760 missense not run
X0018:Col11a1 UTSW 3 114112233 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCACTGACGCTCACCTTG -3'
(R):5'- AATGGACTTAAGACCTCAGCTAC -3'

Sequencing Primer
(F):5'- CCAGTTGAAGAAGGTTTTACTGAAG -3'
(R):5'- AGACCTCAGCTACATTTTAAGCCTG -3'
Posted On2015-04-29