Incidental Mutation 'R3970:Vwa7'
ID310943
Institutional Source Beutler Lab
Gene Symbol Vwa7
Ensembl Gene ENSMUSG00000007030
Gene Namevon Willebrand factor A domain containing 7
SynonymsD17H6S56E-3, G7c
MMRRC Submission 040938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3970 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35016579-35026741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35017708 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 84 (A84T)
Ref Sequence ENSEMBL: ENSMUSP00000133418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000173584]
Predicted Effect probably damaging
Transcript: ENSMUST00000007245
AA Change: A84T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030
AA Change: A84T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087315
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172499
AA Change: A84T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030
AA Change: A84T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172999
Predicted Effect probably benign
Transcript: ENSMUST00000173142
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173336
Predicted Effect probably benign
Transcript: ENSMUST00000173584
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174084
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,322 M583T probably damaging Het
Actn4 T C 7: 28,962,032 K51R probably benign Het
Adamts15 T C 9: 30,910,602 Y513C probably benign Het
Akap13 T A 7: 75,569,951 L34* probably null Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Ano1 T C 7: 144,607,963 N749D probably benign Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cherp T C 8: 72,469,951 H196R possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Col11a1 A T 3: 114,097,189 T392S unknown Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Csf2rb T C 15: 78,341,467 V286A probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Kif5c A G 2: 49,688,744 E128G probably damaging Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Myrf A G 19: 10,223,237 L332P probably damaging Het
Nampt T A 12: 32,833,096 D93E probably benign Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrp6 C A 7: 140,921,655 A45E probably damaging Het
Obscn G A 11: 59,051,662 P4898L probably damaging Het
Olfr251 T C 9: 38,377,926 V15A probably damaging Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pcdh8 C T 14: 79,770,266 G286S possibly damaging Het
Pcdha2 C A 18: 36,940,697 Y460* probably null Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pign A C 1: 105,656,003 S125A probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkd1l1 C T 11: 8,874,218 E1566K probably damaging Het
Plcb2 A G 2: 118,715,690 probably benign Het
Ppl T C 16: 5,100,332 probably null Het
Pramel4 A T 4: 144,068,474 N477I possibly damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Sema3g T C 14: 31,226,521 probably null Het
Sf3b1 G A 1: 55,012,182 R196* probably null Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc6a7 A C 18: 61,003,345 L328R possibly damaging Het
Stab2 T C 10: 86,878,886 T139A probably damaging Het
Tiam2 T A 17: 3,428,831 I613N probably damaging Het
Tlk1 A G 2: 70,716,652 V695A probably damaging Het
Trpc2 A G 7: 102,084,324 D160G probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Zfp219 T A 14: 52,006,964 Q541L probably benign Het
Other mutations in Vwa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Vwa7 APN 17 35024942 missense probably damaging 1.00
IGL01736:Vwa7 APN 17 35019851 missense probably damaging 1.00
IGL01868:Vwa7 APN 17 35021259 missense probably null 0.96
IGL01920:Vwa7 APN 17 35024603 missense probably benign 0.01
IGL02227:Vwa7 APN 17 35020084 missense probably damaging 1.00
IGL02947:Vwa7 APN 17 35023500 splice site probably null
IGL03259:Vwa7 APN 17 35020026 unclassified probably null
IGL03263:Vwa7 APN 17 35021599 missense probably benign 0.16
R0008:Vwa7 UTSW 17 35019805 missense probably benign 0.33
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0057:Vwa7 UTSW 17 35024547 missense possibly damaging 0.85
R0418:Vwa7 UTSW 17 35017957 missense possibly damaging 0.57
R0538:Vwa7 UTSW 17 35022651 missense probably damaging 1.00
R1121:Vwa7 UTSW 17 35017794 missense probably damaging 1.00
R1659:Vwa7 UTSW 17 35019071 missense probably benign 0.04
R1766:Vwa7 UTSW 17 35023943 critical splice donor site probably null
R1777:Vwa7 UTSW 17 35024948 missense probably damaging 1.00
R1793:Vwa7 UTSW 17 35024412 nonsense probably null
R1874:Vwa7 UTSW 17 35017112 missense probably benign 0.00
R2139:Vwa7 UTSW 17 35023430 missense probably benign 0.00
R2248:Vwa7 UTSW 17 35019043 missense probably benign 0.04
R2290:Vwa7 UTSW 17 35017211 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2873:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R2874:Vwa7 UTSW 17 35021242 missense probably damaging 1.00
R3038:Vwa7 UTSW 17 35022661 missense probably damaging 1.00
R3792:Vwa7 UTSW 17 35025159 unclassified probably null
R4612:Vwa7 UTSW 17 35023450 missense probably damaging 0.96
R5013:Vwa7 UTSW 17 35022733 missense probably damaging 1.00
R5068:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5069:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5070:Vwa7 UTSW 17 35024190 missense probably benign 0.25
R5137:Vwa7 UTSW 17 35017846 missense probably damaging 1.00
R5384:Vwa7 UTSW 17 35024926 unclassified probably null
R6170:Vwa7 UTSW 17 35021210 missense possibly damaging 0.56
R6229:Vwa7 UTSW 17 35024265 missense probably benign 0.00
R6249:Vwa7 UTSW 17 35023389 missense probably benign 0.00
R6401:Vwa7 UTSW 17 35017310 splice site probably null
R6429:Vwa7 UTSW 17 35024199 missense probably benign 0.32
R6678:Vwa7 UTSW 17 35019800 missense probably damaging 1.00
R6793:Vwa7 UTSW 17 35024891 missense probably benign 0.06
R6966:Vwa7 UTSW 17 35017096 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTCTTGGGAAAGTCTGTAC -3'
(R):5'- ATGTATATTCGAGGGCTCTGGC -3'

Sequencing Primer
(F):5'- TGTAATCCCAGCACTTAAGGAG -3'
(R):5'- TGGCAGCCACCAGGGTTTC -3'
Posted On2015-04-29