Incidental Mutation 'R3971:Ddr2'
List |< first << previous [record 11 of 41] next >> last >|
ID310956
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Namediscoidin domain receptor family, member 2
SynonymsNtrkr3
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3971 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location169972307-170110762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 169988417 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 574 (F574L)
Ref Sequence ENSEMBL: ENSMUSP00000141443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000194690]
Predicted Effect probably damaging
Transcript: ENSMUST00000027985
AA Change: F574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: F574L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170800
AA Change: F574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: F574L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194690
AA Change: F574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: F574L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169984427 missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169997958 missense probably benign 0.11
IGL00490:Ddr2 APN 1 170005194 missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169984581 missense probably benign
IGL01898:Ddr2 APN 1 169998156 missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169984422 missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169982099 missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169994709 missense probably benign
IGL02330:Ddr2 APN 1 169988524 missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169984945 missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169988513 missense probably benign 0.34
debulked UTSW 1 169982098 missense probably damaging 1.00
fibro UTSW 1 170004812 splice site probably benign
fingers UTSW 1 169988540 missense probably benign 0.16
Julio UTSW 1 169997929 critical splice donor site probably null
phalanges UTSW 1 170005240 nonsense probably null
revolta UTSW 1 169988520 nonsense probably null
R0574:Ddr2 UTSW 1 169981963 splice site probably benign
R0730:Ddr2 UTSW 1 169995566 missense probably benign
R0733:Ddr2 UTSW 1 170004812 splice site probably benign
R0883:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R1340:Ddr2 UTSW 1 169998084 missense probably benign
R1815:Ddr2 UTSW 1 169995601 nonsense probably null
R1921:Ddr2 UTSW 1 170004245 missense probably damaging 1.00
R1924:Ddr2 UTSW 1 169982072 missense probably benign 0.01
R2016:Ddr2 UTSW 1 169984968 missense probably damaging 1.00
R2079:Ddr2 UTSW 1 170004776 nonsense probably null
R2178:Ddr2 UTSW 1 169994682 missense probably benign 0.18
R2903:Ddr2 UTSW 1 169998161 missense probably damaging 1.00
R3051:Ddr2 UTSW 1 169988455 missense probably benign 0.01
R4290:Ddr2 UTSW 1 169990609 missense probably benign 0.00
R4494:Ddr2 UTSW 1 169988414 missense probably damaging 1.00
R4606:Ddr2 UTSW 1 170001852 missense probably benign 0.05
R4721:Ddr2 UTSW 1 170005240 nonsense probably null
R4734:Ddr2 UTSW 1 169998088 missense probably benign 0.41
R4855:Ddr2 UTSW 1 169988497 missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 170004771 missense probably benign 0.19
R4923:Ddr2 UTSW 1 169997929 critical splice donor site probably null
R5207:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R5325:Ddr2 UTSW 1 170001837 missense probably benign 0.00
R5439:Ddr2 UTSW 1 170004729 missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169988520 nonsense probably null
R5833:Ddr2 UTSW 1 170004696 missense probably benign 0.01
R5924:Ddr2 UTSW 1 169994628 missense probably benign 0.03
R6020:Ddr2 UTSW 1 170005102 missense probably benign 0.15
R6270:Ddr2 UTSW 1 169988540 missense probably benign 0.16
R6326:Ddr2 UTSW 1 169987140 missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169987065 missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169982098 missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169998132 missense probably benign 0.01
R7011:Ddr2 UTSW 1 169982103 missense probably damaging 1.00
X0004:Ddr2 UTSW 1 169987098 missense probably benign 0.10
X0027:Ddr2 UTSW 1 169982030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGGAATCCACAGCTCTTAAG -3'
(R):5'- CATGTCTTCTCAGGGTGCAGTG -3'

Sequencing Primer
(F):5'- CTCTTAAGCAAAGATGAGATTGACC -3'
(R):5'- AGCCCAATGGACCTGAGG -3'
Posted On2015-04-29