Incidental Mutation 'R3971:Otop1'
List |< first << previous [record 29 of 41] next >> last >|
ID310963
Institutional Source Beutler Lab
Gene Symbol Otop1
Ensembl Gene ENSMUSG00000051596
Gene Nameotopetrin 1
Synonymstlt, A530025J20Rik
MMRRC Submission 040839-MU
Accession Numbers

NCBI RefSeq: NM_172709.3; MGI:2388363

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3971 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38275972-38304217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38300189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 431 (I431V)
Ref Sequence ENSEMBL: ENSMUSP00000109734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063136] [ENSMUST00000114099]
Predicted Effect probably benign
Transcript: ENSMUST00000063136
AA Change: I428V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000061805
Gene: ENSMUSG00000051596
AA Change: I428V

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 87 106 N/A INTRINSIC
Pfam:Otopetrin 127 239 1.6e-13 PFAM
Pfam:Otopetrin 240 456 1.9e-16 PFAM
low complexity region 462 471 N/A INTRINSIC
Pfam:Otopetrin 518 583 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114099
AA Change: I431V

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109734
Gene: ENSMUSG00000051596
AA Change: I431V

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
Pfam:Otopetrin 130 457 3.1e-40 PFAM
low complexity region 466 475 N/A INTRINSIC
Pfam:Otopetrin 513 587 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187863
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
MGI Phenotype Strain: 4881519; 2655558; 1856638; 4950042
PHENOTYPE: Homozygous mutant mice display vestibular abnormalities associated with absent otoconia. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(1) Chemically induced(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Otop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Otop1 APN 5 38302845 missense probably damaging 1.00
IGL01793:Otop1 APN 5 38299871 missense possibly damaging 0.89
IGL02071:Otop1 APN 5 38287983 missense probably damaging 1.00
IGL02111:Otop1 APN 5 38277701 missense probably benign 0.01
IGL02660:Otop1 APN 5 38288005 missense probably damaging 0.99
IGL02672:Otop1 APN 5 38277826 critical splice donor site probably null
IGL03164:Otop1 APN 5 38287962 nonsense probably null
P0015:Otop1 UTSW 5 38294559 splice site probably benign
R0092:Otop1 UTSW 5 38299830 missense probably damaging 0.97
R0639:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0670:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0673:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R2092:Otop1 UTSW 5 38299766 missense probably damaging 1.00
R2105:Otop1 UTSW 5 38300458 missense probably benign
R2152:Otop1 UTSW 5 38302851 missense probably damaging 1.00
R3972:Otop1 UTSW 5 38300189 missense probably benign 0.04
R4575:Otop1 UTSW 5 38299721 missense probably damaging 1.00
R4660:Otop1 UTSW 5 38300024 missense possibly damaging 0.95
R4998:Otop1 UTSW 5 38294548 critical splice donor site probably null
R5412:Otop1 UTSW 5 38297984 missense probably benign 0.25
R5461:Otop1 UTSW 5 38299715 missense probably damaging 1.00
R5607:Otop1 UTSW 5 38294504 missense possibly damaging 0.68
R5625:Otop1 UTSW 5 38302761 missense probably damaging 1.00
R5677:Otop1 UTSW 5 38300163 missense probably damaging 1.00
R5792:Otop1 UTSW 5 38297916 missense probably benign 0.04
R5878:Otop1 UTSW 5 38277822 missense possibly damaging 0.73
R6163:Otop1 UTSW 5 38287890 splice site probably null
X0064:Otop1 UTSW 5 38299751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAGCTGGATTTACAGGGTG -3'
(R):5'- TGCTGCAGACACAGATTTCC -3'

Sequencing Primer
(F):5'- ATTTACAGGGTGGATGAGAAGTCTC -3'
(R):5'- TTCCATTGACAGCAGGTGAC -3'
Posted On2015-04-29