Incidental Mutation 'R3971:Tmem130'
ID310964
Institutional Source Beutler Lab
Gene Symbol Tmem130
Ensembl Gene ENSMUSG00000043388
Gene Nametransmembrane protein 130
Synonyms
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3971 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144735915-144761818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144755321 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 91 (H91L)
Ref Sequence ENSEMBL: ENSMUSP00000061100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061446]
Predicted Effect probably benign
Transcript: ENSMUST00000061446
AA Change: H91L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061100
Gene: ENSMUSG00000043388
AA Change: H91L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PKD 140 226 6.04e-1 SMART
Blast:PKD 242 332 6e-22 BLAST
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197254
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Tmem130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Tmem130 APN 5 144752445 missense probably damaging 0.99
IGL02808:Tmem130 APN 5 144743623 missense probably damaging 1.00
R0599:Tmem130 UTSW 5 144737809 missense probably damaging 1.00
R0714:Tmem130 UTSW 5 144737809 missense probably damaging 1.00
R1807:Tmem130 UTSW 5 144755364 missense probably benign 0.04
R1858:Tmem130 UTSW 5 144752283 splice site probably null
R1914:Tmem130 UTSW 5 144737856 missense probably damaging 1.00
R1915:Tmem130 UTSW 5 144737856 missense probably damaging 1.00
R2031:Tmem130 UTSW 5 144752426 missense possibly damaging 0.88
R2074:Tmem130 UTSW 5 144755274 missense possibly damaging 0.86
R2145:Tmem130 UTSW 5 144743785 missense probably benign 0.08
R2183:Tmem130 UTSW 5 144755432 missense possibly damaging 0.87
R5092:Tmem130 UTSW 5 144743718 missense probably benign 0.04
R5743:Tmem130 UTSW 5 144750939 missense probably damaging 0.99
R6151:Tmem130 UTSW 5 144737851 missense probably benign 0.41
R6499:Tmem130 UTSW 5 144752414 missense probably damaging 1.00
R7124:Tmem130 UTSW 5 144750911 missense not run
Predicted Primers PCR Primer
(F):5'- ATAGCTCAGTGGGAAACATTTGTC -3'
(R):5'- TTAGTCTTACTGCTGACGGTCC -3'

Sequencing Primer
(F):5'- TGTTTGAGGCTGAAAACATGAAAG -3'
(R):5'- ACTGCTGACGGTCCTGCTAC -3'
Posted On2015-04-29