Incidental Mutation 'R3971:Coro2b'
ID310976
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Namecoronin, actin binding protein, 2B
Synonyms
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3971 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62419492-62537044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62429240 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 251 (A251T)
Ref Sequence ENSEMBL: ENSMUSP00000041826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000173171] [ENSMUST00000174439]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048043
AA Change: A251T

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729
AA Change: A251T

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131981
SMART Domains Protein: ENSMUSP00000133481
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1900 3 97 6.37e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151604
Predicted Effect probably benign
Transcript: ENSMUST00000164246
AA Change: A246T

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729
AA Change: A246T

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173171
SMART Domains Protein: ENSMUSP00000134709
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 16 80 2.89e-31 SMART
Pfam:WD40 87 121 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174439
SMART Domains Protein: ENSMUSP00000134079
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
WD40 1 41 4.95e-4 SMART
WD40 44 83 1.33e-4 SMART
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62425808 missense probably damaging 0.99
IGL01834:Coro2b APN 9 62431357 missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62428961 nonsense probably null
R0422:Coro2b UTSW 9 62427977 missense probably benign 0.00
R0835:Coro2b UTSW 9 62425837 missense possibly damaging 0.68
R0944:Coro2b UTSW 9 62427981 missense probably benign 0.08
R1115:Coro2b UTSW 9 62431327 missense probably damaging 0.96
R1254:Coro2b UTSW 9 62428965 missense probably damaging 0.98
R1422:Coro2b UTSW 9 62428947 critical splice donor site probably null
R1532:Coro2b UTSW 9 62489423 missense probably damaging 1.00
R1543:Coro2b UTSW 9 62425841 missense probably benign 0.32
R3424:Coro2b UTSW 9 62429308 unclassified probably null
R3972:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62425789 unclassified probably benign
R4233:Coro2b UTSW 9 62426185 missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62426578 missense probably benign 0.02
R4825:Coro2b UTSW 9 62454623 missense probably benign 0.30
R5332:Coro2b UTSW 9 62429230 missense probably damaging 0.97
R5702:Coro2b UTSW 9 62426577 missense probably damaging 0.97
R6474:Coro2b UTSW 9 62426628 missense probably benign 0.16
R6500:Coro2b UTSW 9 62489324 missense probably benign 0.24
R6674:Coro2b UTSW 9 62432427 missense probably damaging 1.00
R7102:Coro2b UTSW 9 62421385 missense not run
Predicted Primers PCR Primer
(F):5'- GTTGGTCAGGCTGCATCT -3'
(R):5'- TGCATGTGTTGGAGAAGGAG -3'

Sequencing Primer
(F):5'- CTAAGAAGAGAGTGTGGCTCCTTCC -3'
(R):5'- CTCTTACAAAGACCCTGGTGATGG -3'
Posted On2015-04-29