Incidental Mutation 'R3971:Rbm25'
List |< first << previous [record 31 of 41] next >> last >|
ID310985
Institutional Source Beutler Lab
Gene Symbol Rbm25
Ensembl Gene ENSMUSG00000010608
Gene NameRNA binding motif protein 25
SynonymsA130095G20Rik, 2610015J01Rik, 2600011C06Rik
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R3971 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83631236-83683123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83675208 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 723 (T723A)
Ref Sequence ENSEMBL: ENSMUSP00000048470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048155] [ENSMUST00000181983] [ENSMUST00000182450]
Predicted Effect probably benign
Transcript: ENSMUST00000048155
AA Change: T723A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048470
Gene: ENSMUSG00000010608
AA Change: T723A

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
low complexity region 234 241 N/A INTRINSIC
coiled coil region 270 351 N/A INTRINSIC
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 606 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
PWI 758 831 2.79e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181983
SMART Domains Protein: ENSMUSP00000138572
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
internal_repeat_1 187 203 3e-5 PROSPERO
low complexity region 234 241 N/A INTRINSIC
internal_repeat_1 258 274 3e-5 PROSPERO
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
low complexity region 575 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182450
SMART Domains Protein: ENSMUSP00000138416
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183181
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Rbm25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Rbm25 APN 12 83659567 missense probably damaging 1.00
IGL02095:Rbm25 APN 12 83671974 missense probably damaging 1.00
IGL02227:Rbm25 APN 12 83672753 missense probably damaging 1.00
IGL02454:Rbm25 APN 12 83660322 missense probably benign 0.02
IGL02704:Rbm25 APN 12 83642726 missense probably damaging 1.00
IGL02726:Rbm25 APN 12 83672852 missense probably damaging 1.00
IGL03384:Rbm25 APN 12 83659523 missense probably benign 0.28
R0380:Rbm25 UTSW 12 83660356 missense probably benign 0.02
R0829:Rbm25 UTSW 12 83660376 splice site probably benign
R1330:Rbm25 UTSW 12 83677892 missense probably damaging 1.00
R1346:Rbm25 UTSW 12 83644393 splice site probably benign
R1518:Rbm25 UTSW 12 83668445 missense possibly damaging 0.91
R1566:Rbm25 UTSW 12 83675054 missense probably damaging 0.98
R1660:Rbm25 UTSW 12 83668150 unclassified probably benign
R1809:Rbm25 UTSW 12 83672727 splice site probably benign
R2213:Rbm25 UTSW 12 83676082 missense probably benign 0.00
R2336:Rbm25 UTSW 12 83651418 missense probably damaging 1.00
R2943:Rbm25 UTSW 12 83660641 missense probably damaging 1.00
R4349:Rbm25 UTSW 12 83675173 missense probably damaging 0.99
R4740:Rbm25 UTSW 12 83644407 missense possibly damaging 0.61
R4987:Rbm25 UTSW 12 83677856 missense probably damaging 1.00
R5205:Rbm25 UTSW 12 83672869 missense probably benign 0.03
R5579:Rbm25 UTSW 12 83668507 missense probably benign 0.41
R5603:Rbm25 UTSW 12 83664216 nonsense probably null
R5909:Rbm25 UTSW 12 83681588 missense probably damaging 0.97
R5930:Rbm25 UTSW 12 83677866 missense possibly damaging 0.46
R5982:Rbm25 UTSW 12 83671951 missense probably damaging 0.99
R6233:Rbm25 UTSW 12 83659426 missense probably benign 0.24
R6275:Rbm25 UTSW 12 83644432 missense probably damaging 0.98
R6282:Rbm25 UTSW 12 83676089 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAATATGTTTGCACCTTTTGAGGG -3'
(R):5'- AAACAAGGCTGTATGTCACACTG -3'

Sequencing Primer
(F):5'- AGTGTTTTTAACTATAGGTGCTTCC -3'
(R):5'- GGCTGTATGTCACACTGAAAAC -3'
Posted On2015-04-29