Incidental Mutation 'R3971:Hecw1'
List |< first << previous [record 18 of 41] next >> last >|
ID310988
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3971 (G1)
Quality Score201
Status Validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14236929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1062 (D1062G)
Ref Sequence ENSEMBL: ENSMUSP00000152215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]
Predicted Effect probably damaging
Transcript: ENSMUST00000110516
AA Change: D1489G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: D1489G

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220718
AA Change: D1062G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGCAGCAATTTGAGATAATGGTGTG -3'
(R):5'- AGTCACTTTCCCAATCTGATAGAG -3'

Sequencing Primer
(F):5'- GTACAACTGCTTGATGGCTATCAGC -3'
(R):5'- GTGCTGCAACTGTCTTTC -3'
Posted On2015-04-29