Incidental Mutation 'R3978:Psmd1'
ID311102
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 1
SynonymsS1, P112
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.978) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86064387-86139151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86128187 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 757 (M757T)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
Predicted Effect probably benign
Transcript: ENSMUST00000027432
AA Change: M757T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: M757T

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195317
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86090198 splice site probably benign
IGL02410:Psmd1 APN 1 86077437 missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86078580 missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86128192 missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86118521 missense possibly damaging 0.68
Rickety UTSW 1 86070628 critical splice donor site
R0027:Psmd1 UTSW 1 86094265 splice site probably benign
R0115:Psmd1 UTSW 1 86083271 missense possibly damaging 0.89
R0201:Psmd1 UTSW 1 86118616 missense probably benign 0.11
R0206:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86078582 missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86094290 missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86082039 missense probably benign 0.03
R0790:Psmd1 UTSW 1 86077450 missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86091997 splice site probably benign
R1721:Psmd1 UTSW 1 86071845 missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86075997 missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86082101 splice site probably null
R2118:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2119:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86089997 missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3811:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R4131:Psmd1 UTSW 1 86078700 missense probably damaging 0.98
R4360:Psmd1 UTSW 1 86133737 missense probably damaging 0.97
R4386:Psmd1 UTSW 1 86128192 missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86075951 missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86128204 missense probably benign 0.05
R4783:Psmd1 UTSW 1 86078712 missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86137098 missense probably benign 0.08
R4937:Psmd1 UTSW 1 86083225 missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86090183 missense probably damaging 0.99
R5486:Psmd1 UTSW 1 86137050 missense possibly damaging 0.59
R5979:Psmd1 UTSW 1 86090053 missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86137095 missense probably damaging 1.00
R6425:Psmd1 UTSW 1 86070628 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTTGGAAAGCGTTGGAG -3'
(R):5'- TCTGTAAGGGCTAAGGACTAACTG -3'

Sequencing Primer
(F):5'- TCAGCCTGGTCTACAAAGTG -3'
(R):5'- TGAAGGGGAAATATGGTCATTTATG -3'
Posted On2015-04-29