Incidental Mutation 'R3978:Eif3i'
ID311114
Institutional Source Beutler Lab
Gene Symbol Eif3i
Ensembl Gene ENSMUSG00000028798
Gene Nameeukaryotic translation initiation factor 3, subunit I
SynonymsEif3s2, 36kDa, TRIP-1, D4Ertd632e
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129591960-129600648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129592336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 276 (E276G)
Ref Sequence ENSEMBL: ENSMUSP00000099653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102593] [ENSMUST00000135055]
Predicted Effect probably damaging
Transcript: ENSMUST00000102593
AA Change: E276G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099653
Gene: ENSMUSG00000028798
AA Change: E276G

DomainStartEndE-ValueType
WD40 1 38 1.1e1 SMART
WD40 41 80 1.07e-8 SMART
WD40 135 174 3.84e0 SMART
WD40 177 216 6.63e-5 SMART
Blast:WD40 219 257 2e-18 BLAST
WD40 274 313 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135055
SMART Domains Protein: ENSMUSP00000120776
Gene: ENSMUSG00000028798

DomainStartEndE-ValueType
WD40 2 32 1.54e0 SMART
Blast:WD40 35 78 1e-9 BLAST
WD40 87 126 3.84e0 SMART
WD40 129 163 8.25e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155428
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Eif3i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Eif3i APN 4 129595069 missense probably benign
IGL02222:Eif3i APN 4 129592088 missense possibly damaging 0.89
IGL02975:Eif3i APN 4 129595312 missense probably damaging 0.99
R0683:Eif3i UTSW 4 129593535 missense probably benign 0.12
R0783:Eif3i UTSW 4 129592076 missense possibly damaging 0.85
R0920:Eif3i UTSW 4 129595257 splice site probably benign
R1251:Eif3i UTSW 4 129593385 missense probably damaging 1.00
R2132:Eif3i UTSW 4 129596926 missense probably benign 0.02
R2133:Eif3i UTSW 4 129596926 missense probably benign 0.02
R4781:Eif3i UTSW 4 129595273 missense probably benign 0.11
R4808:Eif3i UTSW 4 129592064 missense probably benign 0.15
R5096:Eif3i UTSW 4 129600444 missense probably damaging 0.97
R5335:Eif3i UTSW 4 129595186 missense probably benign 0.20
R6048:Eif3i UTSW 4 129593352 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACGTAACCATCTTCGCCAC -3'
(R):5'- GAACAGACGTTTGAGTAGTTTGCC -3'

Sequencing Primer
(F):5'- TTCGCCACCGCTGCTGTAG -3'
(R):5'- TGAGTAGTTTGCCTATAGCTCATC -3'
Posted On2015-04-29