Incidental Mutation 'R3978:Yap1'
ID311130
Institutional Source Beutler Lab
Gene Symbol Yap1
Ensembl Gene ENSMUSG00000053110
Gene Nameyes-associated protein 1
SynonymsYki, Yap, yorkie
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3978 (G1)
Quality Score184
Status Validated
Chromosome9
Chromosomal Location7931999-8004596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8004284 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 36 (G36D)
Ref Sequence ENSEMBL: ENSMUSP00000133959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065353] [ENSMUST00000086580] [ENSMUST00000173085] [ENSMUST00000173264] [ENSMUST00000174577]
Predicted Effect probably damaging
Transcript: ENSMUST00000065353
AA Change: G36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069554
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 4e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086580
AA Change: G36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083772
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172870
Predicted Effect probably damaging
Transcript: ENSMUST00000173085
AA Change: G36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134007
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173227
Predicted Effect probably damaging
Transcript: ENSMUST00000173264
AA Change: G36D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134237
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174300
Predicted Effect probably damaging
Transcript: ENSMUST00000174577
AA Change: G36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133959
Gene: ENSMUSG00000053110
AA Change: G36D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174604
SMART Domains Protein: ENSMUSP00000134250
Gene: ENSMUSG00000053110

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
WW 64 96 5.63e-12 SMART
WW 123 155 8.66e-13 SMART
coiled coil region 191 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211167
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Embryos homozygous for a null mutation of this gene die between embryonic days E9.5 and E10.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion. Heterozygous mice are viable, appear normal and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Yap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Yap1 APN 9 7934741 splice site probably benign
IGL01404:Yap1 APN 9 7934741 splice site probably benign
IGL02338:Yap1 APN 9 7962281 critical splice donor site probably null
IGL02398:Yap1 APN 9 7950535 missense probably benign 0.06
IGL02793:Yap1 APN 9 7973906 missense probably benign 0.44
Puddel_hunde UTSW 9 8004284 missense probably damaging 1.00
R0410:Yap1 UTSW 9 8001467 missense probably damaging 1.00
R1507:Yap1 UTSW 9 7953140 splice site probably benign
R1837:Yap1 UTSW 9 7962349 missense probably damaging 1.00
R3968:Yap1 UTSW 9 7973876 missense probably damaging 1.00
R4111:Yap1 UTSW 9 7938431 makesense probably null
R4113:Yap1 UTSW 9 7938431 makesense probably null
R4573:Yap1 UTSW 9 7934681 missense probably damaging 1.00
R5028:Yap1 UTSW 9 8001689 missense probably benign 0.05
R6397:Yap1 UTSW 9 8001466 missense probably damaging 1.00
R6407:Yap1 UTSW 9 7962372 missense possibly damaging 0.46
X0020:Yap1 UTSW 9 7938435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATACCCTTACCTGTCGCGAGTG -3'
(R):5'- CAAAGTTTCTGTCTCAGTTGGGAC -3'

Sequencing Primer
(F):5'- CGAGTGGGACTTGGGCTCAG -3'
(R):5'- TCTCAGTTGGGACGCCGC -3'
Posted On2015-04-29