Incidental Mutation 'R3978:Slc26a3'
ID311143
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Namesolute carrier family 26, member 3
Synonyms9030623B18Rik, 9130013M11Rik, Dra
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31390871-31473917 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 31465860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000171616]
Predicted Effect probably null
Transcript: ENSMUST00000001254
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Meta Mutation Damage Score 0.6444 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably null Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31452491 splice site probably benign
IGL01717:Slc26a3 APN 12 31463477 missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31447831 missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31470833 splice site probably benign
IGL02445:Slc26a3 APN 12 31457052 missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31457096 missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31452629 missense probably damaging 1.00
R0422:Slc26a3 UTSW 12 31465849 missense possibly damaging 0.90
R0544:Slc26a3 UTSW 12 31447740 missense probably benign
R0781:Slc26a3 UTSW 12 31465813 missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31466452 missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31465846 missense probably benign
R1954:Slc26a3 UTSW 12 31450816 missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31465778 missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31457072 missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31470903 missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31464720 missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31453906 missense probably benign 0.00
R4701:Slc26a3 UTSW 12 31447774 missense probably damaging 1.00
R4713:Slc26a3 UTSW 12 31457080 missense possibly damaging 0.75
R5024:Slc26a3 UTSW 12 31453908 missense probably benign
R5058:Slc26a3 UTSW 12 31470965 missense possibly damaging 0.66
R5168:Slc26a3 UTSW 12 31468554 missense possibly damaging 0.81
R5361:Slc26a3 UTSW 12 31450981 critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31448843 critical splice donor site probably null
R5951:Slc26a3 UTSW 12 31452715 intron probably benign
R6662:Slc26a3 UTSW 12 31457346 nonsense probably null
R6895:Slc26a3 UTSW 12 31463524 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTAGTTACTATCGTCACATTCTG -3'
(R):5'- AGCAGCAGGATTTGAGGTAC -3'

Sequencing Primer
(F):5'- CGTCACATTCTGTAACTCTGAGGATG -3'
(R):5'- CCTCAAATATGACATTGGGGCTG -3'
Posted On2015-04-29