Incidental Mutation 'R3978:Azin1'
ID311154
Institutional Source Beutler Lab
Gene Symbol Azin1
Ensembl Gene ENSMUSG00000037458
Gene Nameantizyme inhibitor 1
SynonymsODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik
MMRRC Submission 040941-MU
Accession Numbers

Genbank: NM_018745; MGI: 1859169

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location38487427-38519266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38498713 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 135 (N135K)
Ref Sequence ENSEMBL: ENSMUSP00000119201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000127848] [ENSMUST00000129589] [ENSMUST00000151319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065308
AA Change: N135K

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: N135K

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.2e-66 PFAM
Pfam:Orn_DAP_Arg_deC 282 406 1.4e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110328
AA Change: N65K
SMART Domains Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458
AA Change: N65K

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 9.4e-67 PFAM
Pfam:Orn_DAP_Arg_deC 282 357 7.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110329
AA Change: N135K

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: N135K

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.4e-69 PFAM
Pfam:Orn_DAP_Arg_deC 283 405 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127848
Predicted Effect probably damaging
Transcript: ENSMUST00000129589
AA Change: N135K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458
AA Change: N135K

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 154 1.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149293
Predicted Effect probably damaging
Transcript: ENSMUST00000151319
AA Change: N135K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119201
Gene: ENSMUSG00000037458
AA Change: N135K

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 149 9.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226152
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Azin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Azin1 APN 15 38493486 missense probably benign
IGL02406:Azin1 APN 15 38491565 missense probably benign 0.00
H2330:Azin1 UTSW 15 38497276 missense probably damaging 0.98
R0562:Azin1 UTSW 15 38493581 missense probably benign 0.00
R3416:Azin1 UTSW 15 38493546 missense possibly damaging 0.89
R3434:Azin1 UTSW 15 38493576 missense probably benign 0.00
R4535:Azin1 UTSW 15 38493605 missense probably benign 0.11
R4720:Azin1 UTSW 15 38493500 missense probably benign 0.43
R5266:Azin1 UTSW 15 38491551 missense probably benign
R6416:Azin1 UTSW 15 38492343 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAAATGCTGCCAACCTTTCTC -3'
(R):5'- GTTCAGTCCTCAGCCTTTGG -3'

Sequencing Primer
(F):5'- ATGCTGCCAACCTTTCTCATAAATTC -3'
(R):5'- CCTTTGGCAGGGGAAAAA -3'
Posted On2015-04-29