Incidental Mutation 'R3978:Rxrb'
ID311157
Institutional Source Beutler Lab
Gene Symbol Rxrb
Ensembl Gene ENSMUSG00000039656
Gene Nameretinoid X receptor beta
SynonymsNr2b2, Rub, RCoR-1, H-2RIIBP
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34031812-34038393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34036326 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 209 (P209L)
Ref Sequence ENSEMBL: ENSMUSP00000036585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025186] [ENSMUST00000044858] [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000116612] [ENSMUST00000131134] [ENSMUST00000169397] [ENSMUST00000171872] [ENSMUST00000173354] [ENSMUST00000173554]
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044858
AA Change: P319L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036585
Gene: ENSMUSG00000039656
AA Change: P319L

DomainStartEndE-ValueType
low complexity region 66 85 N/A INTRINSIC
low complexity region 94 121 N/A INTRINSIC
low complexity region 124 147 N/A INTRINSIC
low complexity region 179 186 N/A INTRINSIC
ZnF_C4 189 260 3.98e-39 SMART
low complexity region 269 282 N/A INTRINSIC
low complexity region 305 316 N/A INTRINSIC
HOLI 328 491 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087497
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114252
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114255
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116612
AA Change: P209L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112311
Gene: ENSMUSG00000039656
AA Change: P209L

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 377 1.35e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131134
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect probably benign
Transcript: ENSMUST00000171872
SMART Domains Protein: ENSMUSP00000133146
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 246 4.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173354
AA Change: P209L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133661
Gene: ENSMUSG00000039656
AA Change: P209L

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 381 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173554
SMART Domains Protein: ENSMUSP00000134299
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.9e-11 PFAM
ZnF_C4 79 150 3.98e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174130
Predicted Effect unknown
Transcript: ENSMUST00000174299
AA Change: P257L
SMART Domains Protein: ENSMUSP00000133775
Gene: ENSMUSG00000039656
AA Change: P257L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 52 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
low complexity region 110 117 N/A INTRINSIC
ZnF_C4 120 191 3.98e-39 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
HOLI 259 418 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174740
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutant mice homozygous for a null mutation exhibit partial embryonic and perinatal lethality, and surviving adult males are sterile due to defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V793I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 P432Q probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 N83S probably null Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D649V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 E226G probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I1043T possibly damaging Het
Other mutations in Rxrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Rxrb APN 17 34034075 missense probably damaging 1.00
IGL01337:Rxrb APN 17 34036631 missense probably damaging 1.00
I2505:Rxrb UTSW 17 34033549 splice acceptor site probably benign
R0571:Rxrb UTSW 17 34032132 small deletion probably benign
R1463:Rxrb UTSW 17 34034160 missense probably damaging 1.00
R2312:Rxrb UTSW 17 34032129 missense probably benign
R2395:Rxrb UTSW 17 34037438 missense probably damaging 1.00
R2935:Rxrb UTSW 17 34032132 small deletion probably benign
R5119:Rxrb UTSW 17 34033588 missense probably benign 0.10
R5523:Rxrb UTSW 17 34036437 missense probably damaging 1.00
R5638:Rxrb UTSW 17 34037407 missense probably damaging 1.00
R5769:Rxrb UTSW 17 34032847 missense probably benign
R5894:Rxrb UTSW 17 34035744 missense probably damaging 1.00
R6373:Rxrb UTSW 17 34033559 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGTGAAAGCTCCCTCTTCTC -3'
(R):5'- TGAATATGCACGAGAACGCTG -3'

Sequencing Primer
(F):5'- CTGCTCCCATTGGACAGTC -3'
(R):5'- AGAACGCTGCTGGGGTCAG -3'
Posted On2015-04-29