Incidental Mutation 'R3978:Ankhd1'
ID311158
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36647613 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1906 (H1906L)
Ref Sequence ENSEMBL: ENSMUSP00000120290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: H1906L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: H1906L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000037072
AA Change: H395L
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: H395L

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130035
SMART Domains Protein: ENSMUSP00000117110
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 2 26 5.35e2 SMART
ANK 30 59 9.41e-6 SMART
ANK 63 96 3.8e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140061
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: H1906L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: H1906L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152940
Predicted Effect probably benign
Transcript: ENSMUST00000153612
SMART Domains Protein: ENSMUSP00000116462
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 10 39 9.41e-6 SMART
ANK 43 76 3.8e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155329
AA Change: H1906L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: H1906L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACAAATGTACGCTCTC -3'
(R):5'- GGTCTTAGGCACACAAGCAAAC -3'

Sequencing Primer
(F):5'- GCCAACAAATGTACGCTCTCCTTTC -3'
(R):5'- CAACTGCTTTCTGACGGATGAAG -3'
Posted On2015-04-29