Incidental Mutation 'R3978:Ppp1ca'
ID311161
Institutional Source Beutler Lab
Gene Symbol Ppp1ca
Ensembl Gene ENSMUSG00000040385
Gene Nameprotein phosphatase 1, catalytic subunit, alpha isoform
Synonymsdism2, Ppp1c
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R3978 (G1)
Quality Score168
Status Validated
Chromosome19
Chromosomal Location4192158-4195419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4192254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 13 (I13T)
Ref Sequence ENSEMBL: ENSMUSP00000039109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000045864] [ENSMUST00000046094]
Predicted Effect probably benign
Transcript: ENSMUST00000025740
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045864
SMART Domains Protein: ENSMUSP00000042660
Gene: ENSMUSG00000040247

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
TBC 87 301 7.1e-61 SMART
low complexity region 393 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046094
AA Change: I13T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385
AA Change: I13T

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V793I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 P432Q probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 N83S probably null Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D649V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 E226G probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I1043T possibly damaging Het
Other mutations in Ppp1ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ppp1ca APN 19 4193144 missense probably benign 0.25
IGL00834:Ppp1ca APN 19 4194520 missense probably benign 0.20
IGL01017:Ppp1ca APN 19 4193111 missense probably damaging 0.96
IGL02150:Ppp1ca APN 19 4194699 unclassified probably benign
IGL02295:Ppp1ca APN 19 4194482 nonsense probably null
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R2680:Ppp1ca UTSW 19 4194595 missense possibly damaging 0.81
R4514:Ppp1ca UTSW 19 4195055 missense probably benign
R5131:Ppp1ca UTSW 19 4194896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCTAACTCATCTGAACG -3'
(R):5'- AGAGAAACGCCTGTGCTCAG -3'

Sequencing Primer
(F):5'- TAACTCATCTGAACGCGGCAGG -3'
(R):5'- TAGCTTCGCAGGAGCCTCAC -3'
Posted OnApr 29, 2015